Incidental Mutation 'R5932:Il17a'
ID461886
Institutional Source Beutler Lab
Gene Symbol Il17a
Ensembl Gene ENSMUSG00000025929
Gene Nameinterleukin 17A
SynonymsCtla8, Il17, Ctla-8, IL-17A
Accession Numbers

NCBI RefSeq: NM_010552; MGI:107364

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location20730905-20734496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20733753 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 124 (V124A)
Ref Sequence ENSEMBL: ENSMUSP00000027061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027061]
Predicted Effect probably damaging
Transcript: ENSMUST00000027061
AA Change: V124A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027061
Gene: ENSMUSG00000025929
AA Change: V124A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:IL17 72 150 3.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 5438791
FUNCTION: This gene encodes a pro-inflammatory cytokine that is a member of the interleukin-17 family. The encoded protein plays a central role in host defense against diverse pathogens. The encoded protein is produced by activated T-cells and certain cell types of innate immune system. The active protein functions as either a homodimer with other interleukin-17 family members and signals through the interleukin-17 receptor to induce inflammatory cytokine production. Aberrant expression of this gene is associated with autoinflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced contact, delayed-type and airway hypersensitivity responses and impaired T-dependent antibody production. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Il17a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Il17a APN 1 20732283 missense probably damaging 1.00
IGL01767:Il17a APN 1 20733640 missense probably benign 0.03
seventeenager UTSW 1 20733646 nonsense probably null
R0057:Il17a UTSW 1 20733657 missense probably damaging 1.00
R4597:Il17a UTSW 1 20730993 splice site probably null
R5436:Il17a UTSW 1 20733646 nonsense probably null
R5774:Il17a UTSW 1 20733773 missense probably benign 0.00
R6104:Il17a UTSW 1 20732274 missense probably damaging 1.00
R7142:Il17a UTSW 1 20732103 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGGACTTCATTTCCTCC -3'
(R):5'- CTGAATCTGCCTCTGAATCCAC -3'

Sequencing Primer
(F):5'- GGACTTCATTTCCTCCTGGCTTTTG -3'
(R):5'- TCCTTGCTGAAAATCAATAGCACG -3'
Posted On2017-02-28