Incidental Mutation 'R5932:Thsd7b'
ID461888
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129430838 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 3 (L3P)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040311] [ENSMUST00000073527]
Predicted Effect probably benign
Transcript: ENSMUST00000040311
AA Change: L3P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041716
Gene: ENSMUSG00000042581
AA Change: L3P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 3e-29 BLAST
Blast:TSP1 122 177 7e-24 BLAST
TSP1 182 233 2.47e-9 SMART
Blast:TSP1 290 338 1e-20 BLAST
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 1e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 4e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1051 1.15e-4 SMART
transmembrane domain 1070 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073527
AA Change: L3P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: L3P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148051
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAATCTGTCTGAATAGAAGGAACC -3'
(R):5'- GAATAGTCTCCTAAACGACCATGG -3'

Sequencing Primer
(F):5'- GGAACCAAGTTATATGAGATATCCCC -3'
(R):5'- GTACAAGTGAAAAGCCAGATCATTC -3'
Posted On2017-02-28