Incidental Mutation 'R5932:Casz1'
ID461913
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148939113 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 825 (M825K)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000139806]
Predicted Effect probably benign
Transcript: ENSMUST00000094464
AA Change: M825K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977
AA Change: M825K

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122222
AA Change: M825K

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: M825K

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139806
AA Change: M539K

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120307
Gene: ENSMUSG00000028977
AA Change: M539K

DomainStartEndE-ValueType
low complexity region 117 134 N/A INTRINSIC
ZnF_C2H2 203 228 5.34e0 SMART
ZnF_C2H2 264 288 8.09e-1 SMART
ZnF_C2H2 323 347 9.3e-1 SMART
low complexity region 357 372 N/A INTRINSIC
ZnF_C2H2 381 405 1.1e-2 SMART
low complexity region 412 425 N/A INTRINSIC
low complexity region 442 480 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 524 548 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCAATAGCAAGATGGCAGG -3'
(R):5'- CAGTTTCCCAGTGTGCTTGC -3'

Sequencing Primer
(F):5'- CTCTCTAACTCAGGCCTG -3'
(R):5'- TGCTCACCTGGGTCAAAGG -3'
Posted On2017-02-28