Incidental Mutation 'R2507:Rufy3'
ID476447
Institutional Source Beutler Lab
Gene Symbol Rufy3
Ensembl Gene ENSMUSG00000029291
Gene NameRUN and FYVE domain containing 3
SynonymsRpipx, D5Bwg0860e, 2810428M05Rik, 6330416M07Rik
MMRRC Submission 040413-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2507 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88565040-88651392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88649898 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 645 (S645P)
Ref Sequence ENSEMBL: ENSMUSP00000143302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000198965]
Predicted Effect probably damaging
Transcript: ENSMUST00000198965
AA Change: S645P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143302
Gene: ENSMUSG00000029291
AA Change: S645P

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 2.8e-25 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 555 N/A INTRINSIC
FYVE 597 662 2.9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199956
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RPIP8, UNC-14, and NESCA domain-containing protein that is required for maintenance of neuronal polarity. In addition, it has been implicated in mediation of gastric cancer cell migration and invasion via interaction with P21-activated kinase-1, which promotes its expression. The encoded protein localizes to F-actin-enriched invadopodia to induce formation of protrusions, thereby facilitating cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: The gene product is involved in regulating neuronal polarity and axon growth. Homozygous KO leads to loss of neuronal polarity and causes neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik A G 10: 21,621,782 probably benign Het
4930535I16Rik G A 4: 123,917,947 probably benign Het
Akr1b3 C T 6: 34,310,064 E186K probably damaging Het
Apc A T 18: 34,316,537 N2128I possibly damaging Het
Api5 T C 2: 94,429,817 I31M probably damaging Het
Armcx4 T G X: 134,695,379 V2012G possibly damaging Het
Aurka T C 2: 172,370,445 E4G probably benign Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bsn T C 9: 108,116,114 D813G probably damaging Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
C87499 T A 4: 88,629,211 K161N possibly damaging Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh6 A G 15: 13,041,361 I539T probably benign Het
Cdhr3 T C 12: 33,038,915 D756G probably benign Het
Cenph A T 13: 100,771,236 D85E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clec2h A G 6: 128,673,982 N75S probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Cpne3 A T 4: 19,553,871 N53K probably damaging Het
Cpt1b A G 15: 89,419,098 F585L probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dner A T 1: 84,583,080 C115S probably damaging Het
Dopey1 T A 9: 86,513,117 F759Y probably damaging Het
Dst T C 1: 34,011,909 Y29H probably damaging Het
Dst T C 1: 34,188,417 V1875A possibly damaging Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Emc2 A T 15: 43,511,698 probably null Het
Erich3 A T 3: 154,698,659 E51V probably null Het
Exoc2 A G 13: 30,882,365 Y443H possibly damaging Het
Fbf1 T C 11: 116,155,426 R200G probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Galnt4 A G 10: 99,109,286 K291R possibly damaging Het
Gm12695 T A 4: 96,754,189 E301V probably damaging Het
Gopc C T 10: 52,353,326 probably null Het
Gria1 A T 11: 57,289,320 T699S probably null Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Ikzf2 G A 1: 69,539,288 A282V probably benign Het
Irak2 T C 6: 113,647,678 I45T probably damaging Het
Irx1 T C 13: 71,959,820 K248E probably damaging Het
Kcns3 A C 12: 11,092,086 V204G possibly damaging Het
Lmo1 C A 7: 109,140,641 M91I probably damaging Het
Map3k21 A G 8: 125,939,938 D623G possibly damaging Het
Map4 A G 9: 110,037,483 probably benign Het
Mark3 T A 12: 111,627,242 V236E probably damaging Het
Med23 A G 10: 24,910,813 D939G probably damaging Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Ntng2 T C 2: 29,207,519 N310S probably damaging Het
Olfr1328 T C 4: 118,933,925 M308V probably benign Het
Olfr1414 A G 1: 92,511,378 S217P probably damaging Het
Pcolce A G 5: 137,607,051 V260A possibly damaging Het
Pds5b C A 5: 150,756,428 T533K possibly damaging Het
Pecr A G 1: 72,261,976 Y268H probably benign Het
Phax T A 18: 56,586,884 F299Y probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rpap1 A G 2: 119,780,054 probably null Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spata7 G T 12: 98,658,450 A172S probably benign Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Thop1 T G 10: 81,070,264 M1R probably null Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tpp2 A G 1: 44,001,449 Y290C probably benign Het
Tpr A G 1: 150,392,944 M1V probably null Het
Trim6 T C 7: 104,228,185 F161L probably damaging Het
Ubash3b T C 9: 41,157,354 K25E possibly damaging Het
Unc45b G A 11: 82,940,137 probably null Het
Unc80 A G 1: 66,612,107 N1537S possibly damaging Het
Usb1 T C 8: 95,343,124 F100S probably damaging Het
Vmn1r17 C A 6: 57,361,259 L40F probably damaging Het
Vmn1r233 A T 17: 20,993,848 M280K probably benign Het
Zfp37 A T 4: 62,191,256 C524S probably damaging Het
Zfp426 T C 9: 20,470,431 K420R probably benign Het
Other mutations in Rufy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Rufy3 APN 5 88621350 missense probably damaging 0.96
IGL01964:Rufy3 APN 5 88615070 missense probably damaging 1.00
IGL02537:Rufy3 APN 5 88640662 utr 3 prime probably benign
R0111:Rufy3 UTSW 5 88630584 missense probably damaging 1.00
R0552:Rufy3 UTSW 5 88584270 missense possibly damaging 0.79
R1441:Rufy3 UTSW 5 88632515 missense probably damaging 0.97
R1565:Rufy3 UTSW 5 88640632 missense probably damaging 1.00
R2508:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R3707:Rufy3 UTSW 5 88643032 missense probably benign 0.28
R4907:Rufy3 UTSW 5 88584192 missense possibly damaging 0.95
R4999:Rufy3 UTSW 5 88637226 missense probably damaging 1.00
R5134:Rufy3 UTSW 5 88645567 missense probably benign 0.01
R5420:Rufy3 UTSW 5 88640659 makesense probably null
R5482:Rufy3 UTSW 5 88637332 frame shift probably null
R6029:Rufy3 UTSW 5 88627255 missense probably damaging 1.00
R6254:Rufy3 UTSW 5 88584309 missense probably benign 0.01
R6444:Rufy3 UTSW 5 88637307 missense probably damaging 1.00
R7219:Rufy3 UTSW 5 88649856 missense probably benign 0.22
R7256:Rufy3 UTSW 5 88614947 missense possibly damaging 0.91
R7327:Rufy3 UTSW 5 88642952 missense probably damaging 0.99
R7352:Rufy3 UTSW 5 88637194 missense possibly damaging 0.92
R7484:Rufy3 UTSW 5 88598472 missense probably benign 0.01
X0066:Rufy3 UTSW 5 88617418 missense probably benign 0.10
Predicted Primers
Posted On2017-05-11