Incidental Mutation 'R6091:Mterf4'
ID485899
Institutional Source Beutler Lab
Gene Symbol Mterf4
Ensembl Gene ENSMUSG00000026273
Gene Namemitochondrial transcription termination factor 4
Synonyms4933412H03Rik, Mterfd2, 1810059A23Rik
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93299211-93305915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93301569 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 311 (E311G)
Ref Sequence ENSEMBL: ENSMUSP00000027492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027492] [ENSMUST00000062202] [ENSMUST00000112942] [ENSMUST00000112944]
Predicted Effect probably damaging
Transcript: ENSMUST00000027492
AA Change: E311G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027492
Gene: ENSMUSG00000026273
AA Change: E311G

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Mterf 142 172 1.28e2 SMART
Mterf 177 208 1.1e1 SMART
Mterf 213 244 3.89e0 SMART
Mterf 246 274 2.06e2 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062202
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112942
SMART Domains Protein: ENSMUSP00000108564
Gene: ENSMUSG00000026273

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 7e-55 PDB
Blast:Mterf 142 167 1e-7 BLAST
Blast:Mterf 178 208 8e-13 BLAST
Blast:Mterf 213 235 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112944
AA Change: R241G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108566
Gene: ENSMUSG00000026273
AA Change: R241G

DomainStartEndE-ValueType
PDB:4FP9|H 50 235 6e-54 PDB
Blast:Mterf 142 167 6e-8 BLAST
Blast:Mterf 178 208 2e-12 BLAST
Blast:Mterf 213 235 1e-7 BLAST
low complexity region 253 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with decreased embryo size, lack of heart, and absence of optic discs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Mterf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mterf4 APN 1 93305090 missense possibly damaging 0.83
IGL01686:Mterf4 APN 1 93304721 nonsense probably null
IGL01770:Mterf4 APN 1 93304994 missense probably damaging 1.00
IGL01801:Mterf4 APN 1 93304920 missense probably benign 0.02
IGL01881:Mterf4 APN 1 93304641 missense probably damaging 1.00
IGL02393:Mterf4 APN 1 93302879 missense possibly damaging 0.81
IGL02413:Mterf4 APN 1 93302804 missense probably damaging 1.00
IGL02812:Mterf4 APN 1 93304733 missense probably damaging 1.00
R4083:Mterf4 UTSW 1 93304658 missense possibly damaging 0.85
R4726:Mterf4 UTSW 1 93301749 missense probably damaging 0.98
R4926:Mterf4 UTSW 1 93304925 missense probably benign 0.05
R7065:Mterf4 UTSW 1 93304895 missense probably benign 0.01
X0065:Mterf4 UTSW 1 93301698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCCAGGTGAAGGTCCC -3'
(R):5'- TGCATATTTCAGGATGGGACTCAC -3'

Sequencing Primer
(F):5'- GTCCCCAGCACTTCGAGAATATGAG -3'
(R):5'- TGGGACTCACACATCTAGACATAGTC -3'
Posted On2017-08-16