Incidental Mutation 'R6091:Gbp11'
ID485917
Institutional Source Beutler Lab
Gene Symbol Gbp11
Ensembl Gene ENSMUSG00000092021
Gene Nameguanylate binding protein 11
SynonymsGm7141
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6091 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105323042-105346472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105331388 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 123 (T123N)
Ref Sequence ENSEMBL: ENSMUSP00000098520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100960] [ENSMUST00000171587]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100960
AA Change: T123N

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098520
Gene: ENSMUSG00000092021
AA Change: T123N

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.5e-122 PFAM
Pfam:GBP_C 281 574 3.4e-114 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171587
AA Change: T123N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132552
Gene: ENSMUSG00000092021
AA Change: T123N

DomainStartEndE-ValueType
Pfam:GBP 16 279 4.9e-117 PFAM
Pfam:GBP_C 281 442 2.7e-75 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Gbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Gbp11 APN 5 105327616 critical splice acceptor site probably null
IGL01347:Gbp11 APN 5 105331328 splice site probably benign
IGL01762:Gbp11 APN 5 105327607 missense probably benign
IGL02157:Gbp11 APN 5 105327508 missense possibly damaging 0.95
tilted UTSW 5 105331053 missense probably damaging 1.00
R0550:Gbp11 UTSW 5 105343750 missense probably benign 0.28
R0647:Gbp11 UTSW 5 105330964 missense possibly damaging 0.93
R1530:Gbp11 UTSW 5 105327489 missense probably damaging 0.99
R1612:Gbp11 UTSW 5 105326596 missense possibly damaging 0.72
R1677:Gbp11 UTSW 5 105327411 missense probably damaging 1.00
R1738:Gbp11 UTSW 5 105326644 missense probably benign 0.02
R2063:Gbp11 UTSW 5 105328584 nonsense probably null
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2873:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R3915:Gbp11 UTSW 5 105331112 missense probably damaging 1.00
R4854:Gbp11 UTSW 5 105325508 missense probably damaging 1.00
R5140:Gbp11 UTSW 5 105331053 missense probably damaging 1.00
R5534:Gbp11 UTSW 5 105331038 missense probably damaging 1.00
R6336:Gbp11 UTSW 5 105325489
R6351:Gbp11 UTSW 5 105327598 missense probably benign 0.07
R6956:Gbp11 UTSW 5 105328375 critical splice donor site probably null
Predicted Primers
Posted On2017-08-16