Incidental Mutation 'R6091:Adad1'
ID485907
Institutional Source Beutler Lab
Gene Symbol Adad1
Ensembl Gene ENSMUSG00000027719
Gene Nameadenosine deaminase domain containing 1 (testis specific)
Synonyms
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location37063527-37121930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37084969 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 396 (E396G)
Ref Sequence ENSEMBL: ENSMUSP00000115260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029274] [ENSMUST00000144629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029274
AA Change: E325G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029274
Gene: ENSMUSG00000027719
AA Change: E325G

DomainStartEndE-ValueType
DSRM 79 145 4.04e-15 SMART
low complexity region 154 176 N/A INTRINSIC
ADEAMc 186 547 2.51e-165 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144629
AA Change: E396G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115260
Gene: ENSMUSG00000027719
AA Change: E396G

DomainStartEndE-ValueType
Blast:DSRM 51 108 5e-20 BLAST
DSRM 139 205 4.04e-15 SMART
low complexity region 214 236 N/A INTRINSIC
ADEAMc 246 618 4.77e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148157
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Male mice homozygous for a mutated allele have reduced sperm counts and motility, and increased sperm malformation resulting in background dependent sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Adad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Adad1 APN 3 37092034 missense probably damaging 1.00
IGL01903:Adad1 APN 3 37085082 unclassified probably null
IGL02501:Adad1 APN 3 37083340 missense probably damaging 0.99
IGL02703:Adad1 APN 3 37064241 missense probably damaging 1.00
IGL03354:Adad1 APN 3 37106173 missense probably damaging 1.00
R0042:Adad1 UTSW 3 37083173 unclassified probably benign
R0233:Adad1 UTSW 3 37084948 missense possibly damaging 0.91
R0233:Adad1 UTSW 3 37084948 missense possibly damaging 0.91
R0928:Adad1 UTSW 3 37076740 critical splice donor site probably null
R1704:Adad1 UTSW 3 37092015 missense probably benign
R4081:Adad1 UTSW 3 37064363 splice site probably null
R4596:Adad1 UTSW 3 37065192 missense probably damaging 1.00
R4613:Adad1 UTSW 3 37092033 missense probably damaging 1.00
R4810:Adad1 UTSW 3 37092034 missense probably damaging 1.00
R4855:Adad1 UTSW 3 37085111 missense probably damaging 1.00
R4884:Adad1 UTSW 3 37076664 missense possibly damaging 0.94
R5025:Adad1 UTSW 3 37065210 missense probably damaging 0.97
R5286:Adad1 UTSW 3 37065250 missense possibly damaging 0.75
R5356:Adad1 UTSW 3 37065256 missense probably damaging 1.00
R5948:Adad1 UTSW 3 37083355 critical splice donor site probably null
R7230:Adad1 UTSW 3 37065166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTGCATCTGCTCATATTATCG -3'
(R):5'- GTAAGTCACACATGGTTCCCC -3'

Sequencing Primer
(F):5'- CTGCTCATATTATCGGAATTAGGTG -3'
(R):5'- GCACTAAATATCCCCAAATGTGCTG -3'
Posted On2017-08-16