Incidental Mutation 'R6091:Wbp1'
ID485919
Institutional Source Beutler Lab
Gene Symbol Wbp1
Ensembl Gene ENSMUSG00000030035
Gene NameWW domain binding protein 1
Synonyms
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83119044-83121559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83119487 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 229 (S229G)
Ref Sequence ENSEMBL: ENSMUSP00000122900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032109] [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113935] [ENSMUST00000113936] [ENSMUST00000143814] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably benign
Transcript: ENSMUST00000032109
SMART Domains Protein: ENSMUSP00000032109
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 129 137 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
Pfam:PAPA-1 198 282 1.6e-27 PFAM
Pfam:zf-HIT 294 325 6.1e-10 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032111
AA Change: S230G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035
AA Change: S230G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032114
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113935
SMART Domains Protein: ENSMUSP00000109568
Gene: ENSMUSG00000030034

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
Pfam:PAPA-1 228 309 4e-23 PFAM
Pfam:zf-HIT 324 355 4.3e-11 PFAM
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113936
AA Change: S195G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035
AA Change: S195G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123394
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142493
Predicted Effect probably benign
Transcript: ENSMUST00000143814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145403
Predicted Effect probably benign
Transcript: ENSMUST00000146328
AA Change: S229G

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035
AA Change: S229G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203085
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The globular WW domain, named for the conserved tryptophan residues in the protein motif present in various structural and regulatory proteins, is known to play a role in the mediation of protein-protein interactions. This gene encodes a ligand of the WW domain of the Yes kinase-associated protein. Readthrough transcription of the neighboring upstream gene, which encodes INO80 complex subunit B, into this gene generates a non-coding transcript. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Slc22a19 A G 19: 7,711,063 I44T probably benign Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Wbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Wbp1 APN 6 83120041 missense probably damaging 1.00
R0669:Wbp1 UTSW 6 83119345 missense possibly damaging 0.85
R1269:Wbp1 UTSW 6 83119603 missense probably benign 0.01
R5610:Wbp1 UTSW 6 83120235 missense probably damaging 1.00
R6399:Wbp1 UTSW 6 83120001 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGGACACAGAATCTGGG -3'
(R):5'- GGTCCTTCAGTCATCCATGC -3'

Sequencing Primer
(F):5'- AATCTGGGGGCAGTGCAC -3'
(R):5'- AGCCTACGAGGATGTGGTTCAC -3'
Posted On2017-08-16