Incidental Mutation 'R6132:Exoc4'
ID487175
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Nameexocyst complex component 4
SynonymsSec8l1, Sec8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location33249085-33973979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33758098 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 550 (E550G)
Ref Sequence ENSEMBL: ENSMUSP00000051965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266]
Predicted Effect probably damaging
Transcript: ENSMUST00000052266
AA Change: E550G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: E550G

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143190
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33910587 missense probably benign 0.06
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R2308:Exoc4 UTSW 6 33918568 missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33918408 missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6915:Exoc4 UTSW 6 33921453 missense possibly damaging 0.81
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGAGCCCACAGATACTAATGTG -3'
(R):5'- CTCTTCCCAAGTCATAAATGGTG -3'

Sequencing Primer
(F):5'- CACAGATACTAATGTGTGTGGTGTC -3'
(R):5'- TGTTTCAGGAGATCCAAGACCCTG -3'
Posted On2017-10-10