Incidental Mutation 'R0542:Tada3'
ID49980
Institutional Source Beutler Lab
Gene Symbol Tada3
Ensembl Gene ENSMUSG00000048930
Gene Nametranscriptional adaptor 3
SynonymsADA3, Tada3l, 1110004B19Rik
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113366025-113377883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113375214 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 85 (K85E)
Ref Sequence ENSEMBL: ENSMUSP00000043363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032410] [ENSMUST00000043333] [ENSMUST00000099118] [ENSMUST00000156898] [ENSMUST00000171058] [ENSMUST00000193384] [ENSMUST00000203578] [ENSMUST00000204802]
Predicted Effect probably damaging
Transcript: ENSMUST00000032410
AA Change: K85E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032410
Gene: ENSMUSG00000048930
AA Change: K85E

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 309 430 1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043333
AA Change: K85E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043363
Gene: ENSMUSG00000048930
AA Change: K85E

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 289 413 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099118
SMART Domains Protein: ENSMUSP00000108736
Gene: ENSMUSG00000048930

DomainStartEndE-ValueType
Pfam:Ada3 108 232 6.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113106
SMART Domains Protein: ENSMUSP00000108730
Gene: ENSMUSG00000048930

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113107
SMART Domains Protein: ENSMUSP00000108731
Gene: ENSMUSG00000048930

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125414
Predicted Effect probably benign
Transcript: ENSMUST00000156898
SMART Domains Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 167 8.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171058
SMART Domains Protein: ENSMUSP00000131690
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 91 1.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193384
Predicted Effect probably benign
Transcript: ENSMUST00000203578
SMART Domains Protein: ENSMUSP00000145344
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204802
SMART Domains Protein: ENSMUSP00000144751
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 associated with impaired proliferation of trophoblast cells and absence of inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Tada3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Tada3 APN 6 113376012 missense probably benign 0.41
IGL03256:Tada3 APN 6 113375131 missense possibly damaging 0.83
R0208:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R0698:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R2120:Tada3 UTSW 6 113371015 missense possibly damaging 0.50
R4384:Tada3 UTSW 6 113370379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGCTCCTTCAGCCTTAGCC -3'
(R):5'- CTACCATGCCAAACCGTTTGTGAC -3'

Sequencing Primer
(F):5'- AGAACCTGTTGGGAGCATCATTC -3'
(R):5'- TGAATCAGAATGTAGACCTCCG -3'
Posted On2013-06-12