Incidental Mutation 'R0542:Snx17'
ID49977
Institutional Source Beutler Lab
Gene Symbol Snx17
Ensembl Gene ENSMUSG00000029146
Gene Namesorting nexin 17
SynonymsD5Ertd260e, b2b1625.1Clo, 5830447M19Rik
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31193227-31199143 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 31196551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031029] [ENSMUST00000031562] [ENSMUST00000077693] [ENSMUST00000114590] [ENSMUST00000114603] [ENSMUST00000166769] [ENSMUST00000200730] [ENSMUST00000201154] [ENSMUST00000201231] [ENSMUST00000201535] [ENSMUST00000201535] [ENSMUST00000201679] [ENSMUST00000201968] [ENSMUST00000202124] [ENSMUST00000202758] [ENSMUST00000202929]
Predicted Effect probably null
Transcript: ENSMUST00000031029
SMART Domains Protein: ENSMUSP00000031029
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 105 3.42e-24 SMART
B41 113 274 4.05e-2 SMART
low complexity region 324 342 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031562
SMART Domains Protein: ENSMUSP00000031562
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
low complexity region 100 117 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
ZnF_C2H2 148 170 1.33e-1 SMART
ZnF_C2H2 176 198 2.86e-1 SMART
ZnF_C2H2 204 226 1.06e-4 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C2H2 358 380 1.03e-2 SMART
ZnF_C2H2 386 408 5.42e-2 SMART
ZnF_C2H2 414 436 2.91e-2 SMART
ZnF_C2H2 442 464 1.38e-3 SMART
ZnF_C2H2 470 492 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077693
SMART Domains Protein: ENSMUSP00000076875
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 29 60 N/A INTRINSIC
coiled coil region 93 122 N/A INTRINSIC
Pfam:IF-2B 219 510 3.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114590
SMART Domains Protein: ENSMUSP00000110238
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 37 57 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 146 N/A INTRINSIC
ZnF_C2H2 150 172 1.33e-1 SMART
ZnF_C2H2 178 200 2.86e-1 SMART
ZnF_C2H2 206 228 1.06e-4 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
ZnF_C2H2 360 382 1.03e-2 SMART
ZnF_C2H2 388 410 5.42e-2 SMART
ZnF_C2H2 416 438 2.91e-2 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
ZnF_C2H2 472 494 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114603
SMART Domains Protein: ENSMUSP00000110250
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132471
SMART Domains Protein: ENSMUSP00000116961
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 23 3e-7 BLAST
PDB:3LUI|C 1 23 3e-8 PDB
low complexity region 24 35 N/A INTRINSIC
Blast:B41 36 169 5e-92 BLAST
PDB:4GXB|A 36 169 4e-90 PDB
Predicted Effect probably null
Transcript: ENSMUST00000147145
SMART Domains Protein: ENSMUSP00000135387
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 87 2.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166769
SMART Domains Protein: ENSMUSP00000130880
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200724
Predicted Effect probably benign
Transcript: ENSMUST00000200730
SMART Domains Protein: ENSMUSP00000144504
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 87 2.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201119
Predicted Effect probably benign
Transcript: ENSMUST00000201154
SMART Domains Protein: ENSMUSP00000143802
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201231
SMART Domains Protein: ENSMUSP00000144172
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201343
Predicted Effect probably null
Transcript: ENSMUST00000201535
SMART Domains Protein: ENSMUSP00000144643
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 23 3e-7 BLAST
PDB:3LUI|C 1 23 3e-8 PDB
low complexity region 24 35 N/A INTRINSIC
Blast:B41 36 169 5e-92 BLAST
PDB:4GXB|A 36 169 4e-90 PDB
Predicted Effect probably null
Transcript: ENSMUST00000201535
SMART Domains Protein: ENSMUSP00000144643
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 23 3e-7 BLAST
PDB:3LUI|C 1 23 3e-8 PDB
low complexity region 24 35 N/A INTRINSIC
Blast:B41 36 169 5e-92 BLAST
PDB:4GXB|A 36 169 4e-90 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201679
SMART Domains Protein: ENSMUSP00000144688
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Pfam:PX 6 67 2.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201835
Predicted Effect probably benign
Transcript: ENSMUST00000201968
SMART Domains Protein: ENSMUSP00000144517
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 80 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202032
Predicted Effect probably benign
Transcript: ENSMUST00000202124
SMART Domains Protein: ENSMUSP00000144168
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 31 6e-8 BLAST
PDB:3LUI|C 1 31 4e-9 PDB
low complexity region 41 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202743
Predicted Effect probably benign
Transcript: ENSMUST00000202758
SMART Domains Protein: ENSMUSP00000144361
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202929
SMART Domains Protein: ENSMUSP00000143817
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Meta Mutation Damage Score 0.654 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a B41 domain. This protein interacts with the cytoplasmic domain of P-selectin, and may function in the intracellular trafficking of P-selectin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU_induced mutation exhibit double outlet right ventricle (DORV)/overriding aorta (Ao) and atrioventricular septal defect (AVSD). Noncardiac phenotypes include anopthalmia and duplex kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Snx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Snx17 APN 5 31197335 missense probably damaging 0.99
IGL01406:Snx17 APN 5 31195994 missense probably damaging 1.00
IGL01955:Snx17 APN 5 31197082 unclassified probably benign
IGL02724:Snx17 APN 5 31197046 missense probably damaging 1.00
IGL03032:Snx17 APN 5 31196011 missense probably benign 0.03
IGL03277:Snx17 APN 5 31195740 unclassified probably benign
R1188:Snx17 UTSW 5 31195822 missense probably benign 0.18
R4597:Snx17 UTSW 5 31198513 unclassified probably benign
R4983:Snx17 UTSW 5 31195794 missense possibly damaging 0.80
R7156:Snx17 UTSW 5 31197348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCATTGATTACCCCAGAGTTGC -3'
(R):5'- AGCCATGCTCAATGTCTGACACC -3'

Sequencing Primer
(F):5'- CAATTGTTCGCTTGCCCATTTTC -3'
(R):5'- caggaggcaaaggcagg -3'
Posted On2013-06-12