Incidental Mutation 'R0542:Zfp423'
ID49984
Institutional Source Beutler Lab
Gene Symbol Zfp423
Ensembl Gene ENSMUSG00000045333
Gene Namezinc finger protein 423
SynonymsZfp104, ataxia1, Ebfaz, Roaz
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location87661810-87959595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87780609 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 911 (T911A)
Ref Sequence ENSEMBL: ENSMUSP00000129724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052250] [ENSMUST00000109655] [ENSMUST00000165770] [ENSMUST00000174249] [ENSMUST00000174764]
Predicted Effect probably damaging
Transcript: ENSMUST00000052250
AA Change: T1015A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052379
Gene: ENSMUSG00000045333
AA Change: T1015A

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
ZnF_C2H2 54 75 5.07e0 SMART
low complexity region 107 123 N/A INTRINSIC
ZnF_C2H2 125 147 1.28e-3 SMART
ZnF_C2H2 153 175 1.64e-1 SMART
ZnF_C2H2 181 203 2.05e-2 SMART
ZnF_C2H2 209 231 3.21e-4 SMART
ZnF_C2H2 250 273 5.42e-2 SMART
ZnF_C2H2 282 305 1.76e-1 SMART
ZnF_C2H2 310 332 8.67e-1 SMART
low complexity region 350 364 N/A INTRINSIC
ZnF_C2H2 396 420 1.16e-1 SMART
ZnF_C2H2 428 451 3.52e-1 SMART
ZnF_C2H2 467 490 7.9e-4 SMART
low complexity region 492 503 N/A INTRINSIC
ZnF_C2H2 504 527 2.53e-2 SMART
ZnF_C2H2 550 575 3.99e0 SMART
low complexity region 591 602 N/A INTRINSIC
ZnF_C2H2 619 641 3.16e-3 SMART
ZnF_C2H2 649 671 5.81e-2 SMART
ZnF_C2H2 679 702 4.87e-4 SMART
ZnF_C2H2 707 730 7.26e-3 SMART
ZnF_C2H2 737 760 4.79e-3 SMART
ZnF_C2H2 768 790 1.36e-2 SMART
ZnF_C2H2 794 817 4.72e-2 SMART
ZnF_C2H2 873 896 4.12e0 SMART
ZnF_C2H2 917 939 5.59e-4 SMART
ZnF_C2H2 946 968 6.42e-4 SMART
ZnF_C2H2 975 997 4.94e0 SMART
ZnF_C2H2 1007 1029 4.99e1 SMART
Pfam:zf-C2H2_6 1050 1068 1.6e-1 PFAM
ZnF_C2H2 1107 1130 1.12e-3 SMART
ZnF_C2H2 1155 1177 1.45e-2 SMART
ZnF_C2H2 1185 1207 5.72e-1 SMART
ZnF_C2H2 1216 1239 1.18e-2 SMART
ZnF_C2H2 1246 1269 4.05e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109655
AA Change: T1036A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: T1036A

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
ZnF_C2H2 75 96 5.07e0 SMART
low complexity region 128 144 N/A INTRINSIC
ZnF_C2H2 146 168 1.28e-3 SMART
ZnF_C2H2 174 196 1.64e-1 SMART
ZnF_C2H2 202 224 2.05e-2 SMART
ZnF_C2H2 230 252 3.21e-4 SMART
ZnF_C2H2 271 294 5.42e-2 SMART
ZnF_C2H2 303 326 1.76e-1 SMART
ZnF_C2H2 331 353 8.67e-1 SMART
low complexity region 371 385 N/A INTRINSIC
ZnF_C2H2 417 441 1.16e-1 SMART
ZnF_C2H2 449 472 3.52e-1 SMART
ZnF_C2H2 488 511 7.9e-4 SMART
low complexity region 513 524 N/A INTRINSIC
ZnF_C2H2 525 548 2.53e-2 SMART
ZnF_C2H2 571 596 3.99e0 SMART
low complexity region 612 623 N/A INTRINSIC
ZnF_C2H2 640 662 3.16e-3 SMART
ZnF_C2H2 670 692 5.81e-2 SMART
ZnF_C2H2 700 723 4.87e-4 SMART
ZnF_C2H2 728 751 7.26e-3 SMART
ZnF_C2H2 758 781 4.79e-3 SMART
ZnF_C2H2 789 811 1.36e-2 SMART
ZnF_C2H2 815 838 4.72e-2 SMART
ZnF_C2H2 894 917 4.12e0 SMART
ZnF_C2H2 938 960 5.59e-4 SMART
ZnF_C2H2 967 989 6.42e-4 SMART
ZnF_C2H2 996 1018 4.94e0 SMART
ZnF_C2H2 1028 1050 4.99e1 SMART
ZnF_C2H2 1128 1151 1.12e-3 SMART
ZnF_C2H2 1176 1198 1.45e-2 SMART
ZnF_C2H2 1206 1228 5.72e-1 SMART
ZnF_C2H2 1237 1260 1.18e-2 SMART
ZnF_C2H2 1267 1290 4.05e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165770
AA Change: T911A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129724
Gene: ENSMUSG00000045333
AA Change: T911A

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
ZnF_C2H2 21 43 1.28e-3 SMART
ZnF_C2H2 49 71 1.64e-1 SMART
ZnF_C2H2 77 99 2.05e-2 SMART
ZnF_C2H2 105 127 3.21e-4 SMART
ZnF_C2H2 146 169 5.42e-2 SMART
ZnF_C2H2 178 201 1.76e-1 SMART
ZnF_C2H2 206 228 8.67e-1 SMART
low complexity region 246 260 N/A INTRINSIC
ZnF_C2H2 292 316 1.16e-1 SMART
ZnF_C2H2 324 347 3.52e-1 SMART
ZnF_C2H2 363 386 7.9e-4 SMART
low complexity region 388 399 N/A INTRINSIC
ZnF_C2H2 400 423 2.53e-2 SMART
ZnF_C2H2 446 471 3.99e0 SMART
low complexity region 487 498 N/A INTRINSIC
ZnF_C2H2 515 537 3.16e-3 SMART
ZnF_C2H2 545 567 5.81e-2 SMART
ZnF_C2H2 575 598 4.87e-4 SMART
ZnF_C2H2 603 626 7.26e-3 SMART
ZnF_C2H2 633 656 4.79e-3 SMART
ZnF_C2H2 664 686 1.36e-2 SMART
ZnF_C2H2 690 713 4.72e-2 SMART
ZnF_C2H2 769 792 4.12e0 SMART
ZnF_C2H2 813 835 5.59e-4 SMART
ZnF_C2H2 842 864 6.42e-4 SMART
ZnF_C2H2 871 893 4.94e0 SMART
ZnF_C2H2 903 925 4.99e1 SMART
Pfam:zf-C2H2_6 946 964 2.5e-1 PFAM
ZnF_C2H2 1003 1026 1.12e-3 SMART
ZnF_C2H2 1051 1073 1.45e-2 SMART
ZnF_C2H2 1081 1103 5.72e-1 SMART
ZnF_C2H2 1112 1135 1.18e-2 SMART
ZnF_C2H2 1142 1165 4.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173725
Predicted Effect probably benign
Transcript: ENSMUST00000174249
SMART Domains Protein: ENSMUSP00000134103
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
ZnF_C2H2 78 100 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174764
SMART Domains Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
ZnF_C2H2 78 99 5.07e0 SMART
low complexity region 131 147 N/A INTRINSIC
ZnF_C2H2 149 171 1.28e-3 SMART
ZnF_C2H2 177 199 1.64e-1 SMART
ZnF_C2H2 205 227 2.05e-2 SMART
Pfam:zf-C2H2_6 232 244 2.5e-1 PFAM
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Zfp423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Zfp423 APN 8 87781611 unclassified probably null
IGL01359:Zfp423 APN 8 87780662 missense probably damaging 1.00
IGL01780:Zfp423 APN 8 87781508 missense probably damaging 1.00
IGL02250:Zfp423 APN 8 87783255 missense probably damaging 1.00
IGL02301:Zfp423 APN 8 87781574 missense probably damaging 1.00
IGL02320:Zfp423 APN 8 87781602 missense probably damaging 1.00
IGL02804:Zfp423 APN 8 87782657 missense probably benign 0.02
IGL03090:Zfp423 APN 8 87781443 missense probably damaging 1.00
IGL03198:Zfp423 APN 8 87781676 missense possibly damaging 0.73
IGL03383:Zfp423 APN 8 87859452 nonsense probably null
swell UTSW 8 87686559 splice site probably null
R0110:Zfp423 UTSW 8 87782259 missense possibly damaging 0.60
R0142:Zfp423 UTSW 8 87780340 nonsense probably null
R0256:Zfp423 UTSW 8 87773634 nonsense probably null
R0538:Zfp423 UTSW 8 87782085 missense probably damaging 0.99
R0614:Zfp423 UTSW 8 87782114 missense probably damaging 1.00
R1179:Zfp423 UTSW 8 87688072 missense probably damaging 0.97
R1417:Zfp423 UTSW 8 87773656 splice site probably null
R1429:Zfp423 UTSW 8 87686442 missense probably damaging 0.99
R1570:Zfp423 UTSW 8 87782558 missense probably benign 0.37
R2013:Zfp423 UTSW 8 87782397 missense probably benign 0.43
R2043:Zfp423 UTSW 8 87782618 missense probably damaging 1.00
R2064:Zfp423 UTSW 8 87781358 missense probably benign 0.04
R2108:Zfp423 UTSW 8 87781178 missense possibly damaging 0.73
R2358:Zfp423 UTSW 8 87780551 missense possibly damaging 0.56
R3177:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3277:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3738:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3739:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3773:Zfp423 UTSW 8 87780512 missense probably benign 0.03
R4034:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R4425:Zfp423 UTSW 8 87782973 missense probably damaging 1.00
R4611:Zfp423 UTSW 8 87688081 missense possibly damaging 0.90
R4700:Zfp423 UTSW 8 87781710 unclassified probably null
R4753:Zfp423 UTSW 8 87781446 missense probably benign 0.00
R4818:Zfp423 UTSW 8 87904500 missense probably benign 0.00
R5026:Zfp423 UTSW 8 87780674 missense probably damaging 1.00
R5190:Zfp423 UTSW 8 87782463 missense probably damaging 1.00
R5243:Zfp423 UTSW 8 87773647 missense probably benign 0.03
R5284:Zfp423 UTSW 8 87781677 missense possibly damaging 0.73
R5586:Zfp423 UTSW 8 87859340 missense possibly damaging 0.93
R5601:Zfp423 UTSW 8 87782009 missense probably damaging 1.00
R5671:Zfp423 UTSW 8 87782327 missense probably damaging 0.99
R5717:Zfp423 UTSW 8 87686559 splice site probably null
R5801:Zfp423 UTSW 8 87859362 missense probably damaging 0.99
R5917:Zfp423 UTSW 8 87782232 nonsense probably null
R5985:Zfp423 UTSW 8 87782146 missense possibly damaging 0.83
R6111:Zfp423 UTSW 8 87782687 missense probably damaging 0.99
R6306:Zfp423 UTSW 8 87782034 missense possibly damaging 0.64
R6770:Zfp423 UTSW 8 87781817 missense probably damaging 0.99
R6970:Zfp423 UTSW 8 87803779 missense probably benign 0.00
R7029:Zfp423 UTSW 8 87688066 missense probably damaging 0.99
R7060:Zfp423 UTSW 8 87782879 missense probably damaging 1.00
R7074:Zfp423 UTSW 8 87782432 missense probably benign 0.00
R7121:Zfp423 UTSW 8 87780861 missense probably damaging 1.00
R7242:Zfp423 UTSW 8 87904527 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTGACATCAAGCCTGACCAGGTCC -3'
(R):5'- AGCCATAAGTGTAACGTGTGCTCTC -3'

Sequencing Primer
(F):5'- GTCCTGCTTGCTACGGAAC -3'
(R):5'- ACTTTCTTCTCGGAGAACGG -3'
Posted On2013-06-12