Incidental Mutation 'R0542:Pdgfd'
ID49986
Institutional Source Beutler Lab
Gene Symbol Pdgfd
Ensembl Gene ENSMUSG00000032006
Gene Nameplatelet-derived growth factor, D polypeptide
Synonyms1110003I09Rik
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6168584-6378850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6359769 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 280 (N280S)
Ref Sequence ENSEMBL: ENSMUSP00000128388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058692] [ENSMUST00000168039] [ENSMUST00000214892]
Predicted Effect probably damaging
Transcript: ENSMUST00000058692
AA Change: N274S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056240
Gene: ENSMUSG00000032006
AA Change: N274S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 48 164 5.38e-25 SMART
PDGF 265 358 4.58e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168039
AA Change: N280S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128388
Gene: ENSMUSG00000032006
AA Change: N280S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 54 170 5.38e-25 SMART
PDGF 271 364 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214892
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. This gene product only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. Two splice variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Pdgfd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Pdgfd APN 9 6288621 nonsense probably null
IGL00806:Pdgfd APN 9 6288667 missense probably benign 0.00
IGL01481:Pdgfd APN 9 6337271 missense probably null 0.62
IGL01704:Pdgfd APN 9 6337327 missense probably damaging 1.00
IGL02951:Pdgfd APN 9 6288494 missense probably damaging 1.00
IGL03022:Pdgfd APN 9 6288495 missense probably damaging 1.00
R0122:Pdgfd UTSW 9 6293851 missense probably damaging 1.00
R0408:Pdgfd UTSW 9 6293928 nonsense probably null
R0701:Pdgfd UTSW 9 6359706 missense probably damaging 0.98
R1376:Pdgfd UTSW 9 6376994 missense probably benign 0.00
R1376:Pdgfd UTSW 9 6376994 missense probably benign 0.00
R1563:Pdgfd UTSW 9 6293939 critical splice donor site probably null
R2513:Pdgfd UTSW 9 6359894 missense probably damaging 1.00
R3751:Pdgfd UTSW 9 6337447 splice site probably benign
R3831:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R3832:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R3833:Pdgfd UTSW 9 6359762 missense probably damaging 1.00
R4691:Pdgfd UTSW 9 6288556 missense probably damaging 1.00
R6280:Pdgfd UTSW 9 6288627 missense probably benign 0.00
R6622:Pdgfd UTSW 9 6293818 missense probably damaging 1.00
R7488:Pdgfd UTSW 9 6359739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAAGTTGTAGGGCTTGAACC -3'
(R):5'- GGCCTGACATTACTGATGCTGTACC -3'

Sequencing Primer
(F):5'- GTGTTCCATAGTAAGATCCCAGG -3'
(R):5'- ACTGATGCTGTACCTCATGATAC -3'
Posted On2013-06-12