Incidental Mutation 'R5817:Trpm2'
ID501575
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77965980 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 84 (G84W)
Ref Sequence ENSEMBL: ENSMUSP00000151231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105399] [ENSMUST00000105401] [ENSMUST00000219997]
Predicted Effect probably damaging
Transcript: ENSMUST00000105399
AA Change: G84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101038
Gene: ENSMUSG00000009292
AA Change: G84C

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: G84W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: G84W

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154996
Predicted Effect probably damaging
Transcript: ENSMUST00000219997
AA Change: G84W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGATGGTCTGGACATGCTC -3'
(R):5'- ACAGGGAGCCTTTAAGCTTTG -3'

Sequencing Primer
(F):5'- TCCCCAAGTGTCTCCTGAAATGAG -3'
(R):5'- AGCCTTTAAGCTTTGAGGTAGC -3'
Posted On2017-12-01