Incidental Mutation 'R6092:Trpm2'
ID485996
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 044249-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R6092 (G1)
Quality Score97.0078
Status Validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77925682 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1045 (F1045L)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: F1045L

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: F1045L

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217806
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,940 P1297S probably benign Het
4930486L24Rik C T 13: 60,853,647 V89M probably benign Het
Abhd16a T C 17: 35,098,810 probably null Het
Abtb1 A C 6: 88,838,451 C264G probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arid1a C T 4: 133,693,852 G881R unknown Het
Asb8 A G 15: 98,136,242 V144A possibly damaging Het
Atm A C 9: 53,524,414 C199G probably damaging Het
Atxn1 C A 13: 45,566,812 V536L probably benign Het
Baz1a C T 12: 54,909,083 V1074M possibly damaging Het
BC034090 T A 1: 155,224,913 D535V probably damaging Het
Casp8ap2 C A 4: 32,639,380 H145N probably damaging Het
Ccdc24 T A 4: 117,872,448 K25* probably null Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Cdh7 A T 1: 110,098,306 Y424F probably benign Het
Clasp1 T C 1: 118,510,298 S612P probably damaging Het
Cxcl14 T C 13: 56,295,833 M55V possibly damaging Het
Dnah11 T C 12: 117,928,456 T3661A probably benign Het
Dnah14 T A 1: 181,621,833 D574E probably benign Het
Dnah6 C T 6: 73,114,697 V2204M possibly damaging Het
Ercc4 A T 16: 13,125,261 H178L probably benign Het
Far2 T C 6: 148,175,083 F475L probably benign Het
Ggt7 A G 2: 155,518,039 probably null Het
Gm4131 T A 14: 62,480,915 T81S possibly damaging Het
Gprc6a A G 10: 51,615,077 S788P probably damaging Het
Hmgxb3 C A 18: 61,137,600 G884V possibly damaging Het
Homer1 T A 13: 93,366,437 probably benign Het
Iars T C 13: 49,708,421 S483P probably damaging Het
Kansl1l C G 1: 66,773,484 E457Q probably damaging Het
Krtap4-9 G A 11: 99,785,655 probably benign Het
Lepr C A 4: 101,792,023 P874T probably damaging Het
Mad2l2 T A 4: 148,143,610 F100L probably damaging Het
Mavs A T 2: 131,245,598 R339* probably null Het
Mettl1 G A 10: 127,041,974 probably benign Het
Mfsd8 A G 3: 40,819,596 V493A possibly damaging Het
Mtmr9 C T 14: 63,542,452 V63M possibly damaging Het
Mto1 T C 9: 78,460,849 I425T possibly damaging Het
Olfr332 A T 11: 58,490,074 M227K probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr998 A G 2: 85,590,606 Y22C probably benign Het
Pclo C T 5: 14,677,923 probably benign Het
Phf2 T C 13: 48,816,057 D608G unknown Het
Plch2 T C 4: 154,984,372 T1266A probably benign Het
Prdm12 A G 2: 31,643,877 N169D probably damaging Het
Rimbp3 A G 16: 17,212,270 Y1186C probably damaging Het
Serpinb3d T C 1: 107,079,259 M240V probably damaging Het
Slc25a38 C T 9: 120,116,592 R74C probably damaging Het
Slc25a39 A T 11: 102,404,893 Y109* probably null Het
Slc26a8 T C 17: 28,648,155 N564S probably damaging Het
Spag4 G A 2: 156,065,776 probably benign Het
Stx1b A G 7: 127,807,863 M74T possibly damaging Het
Tbc1d1 A G 5: 64,349,899 D1153G probably benign Het
Tert T C 13: 73,628,581 F484L probably benign Het
Tet1 A G 10: 62,813,715 V72A probably benign Het
Tnfrsf13c T C 15: 82,223,154 T147A probably damaging Het
Trpa1 A T 1: 14,889,486 Y659N probably damaging Het
Ttc13 T C 8: 124,679,033 H529R probably benign Het
Ttn T C 2: 76,715,270 T32570A probably damaging Het
Uba7 A G 9: 107,983,160 T892A possibly damaging Het
Uty A T Y: 1,174,836 M195K probably benign Het
Zfp109 A G 7: 24,229,553 S152P possibly damaging Het
Zfp532 T C 18: 65,644,210 V846A probably damaging Het
Zfp658 A T 7: 43,574,527 H742L possibly damaging Het
Zfp831 C A 2: 174,705,506 P1494Q probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATAGTACAGACAAGGGCTTCTGGG -3'
(R):5'- GTTGCCCTGGTAACTCACTG -3'

Sequencing Primer
(F):5'- GCCCCCAGGAATGGTGAC -3'
(R):5'- TGCCCAAAGGTGTGAATTTCAGC -3'
Posted On2017-08-16