Incidental Mutation 'R6208:Sf3b2'
ID503296
Institutional Source Beutler Lab
Gene Symbol Sf3b2
Ensembl Gene ENSMUSG00000024853
Gene Namesplicing factor 3b, subunit 2
Synonyms145kDa, 2610311M13Rik, 2810441F20Rik, SF3b150, SF3b145, B230398H18Rik, SAP145, SF3b1
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.975) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5273923-5295455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5275098 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 782 (M782K)
Ref Sequence ENSEMBL: ENSMUSP00000025774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025774] [ENSMUST00000025786]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025774
AA Change: M782K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025774
Gene: ENSMUSG00000024853
AA Change: M782K

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
SAP 24 58 1.84e-4 SMART
low complexity region 91 132 N/A INTRINSIC
coiled coil region 140 178 N/A INTRINSIC
low complexity region 201 221 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
low complexity region 408 437 N/A INTRINSIC
Pfam:DUF382 453 579 2.9e-63 PFAM
PSP 584 642 9.41e-33 SMART
low complexity region 693 717 N/A INTRINSIC
low complexity region 745 756 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025786
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Sf3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sf3b2 APN 19 5279587 missense probably benign 0.00
IGL01737:Sf3b2 APN 19 5279838 splice site probably benign
IGL02205:Sf3b2 APN 19 5283737 missense probably benign 0.01
R0184:Sf3b2 UTSW 19 5283672 missense probably damaging 1.00
R0370:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0371:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0372:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0373:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0375:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R1606:Sf3b2 UTSW 19 5287998 missense probably benign 0.00
R1609:Sf3b2 UTSW 19 5295033 unclassified probably benign
R2566:Sf3b2 UTSW 19 5275090 missense possibly damaging 0.92
R5163:Sf3b2 UTSW 19 5275137 missense probably damaging 1.00
R6275:Sf3b2 UTSW 19 5283650 missense probably damaging 1.00
R6644:Sf3b2 UTSW 19 5279964 splice site probably null
R6986:Sf3b2 UTSW 19 5279895 missense probably benign
R7007:Sf3b2 UTSW 19 5274517 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TACTTCTGCGTCATGGCCATG -3'
(R):5'- CCTTCAGCCGTAGTTATCTTGGG -3'

Sequencing Primer
(F):5'- GGGTCCAACTCCAATTCCTCAGG -3'
(R):5'- CAGCCGTAGTTATCTTGGGATTCTC -3'
Posted On2018-02-27