Incidental Mutation 'R6208:Spata31d1a'
ID503284
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6208 (G1)
Quality Score91.0077
Status Not validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59700564 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 1250 (R1250M)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect probably damaging
Transcript: ENSMUST00000066510
AA Change: R1250M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: R1250M

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect probably damaging
Transcript: ENSMUST00000224982
AA Change: R1250M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 unclassified probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense not run
Predicted Primers PCR Primer
(F):5'- TTTTCCTGTAGGGCCACACC -3'
(R):5'- TCAGGAAAATCAGTTCACCAGC -3'

Sequencing Primer
(F):5'- CACTGGAGAGCAGGAACCTCTG -3'
(R):5'- CCAGGTGAAGGGCTTCTG -3'
Posted On2018-02-27