Incidental Mutation 'R6263:Gm11639'
ID506842
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104919486 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 3150 (D3150N)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000212287
AA Change: D3150N
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAACTTTATATGCCCCAGTACAGG -3'
(R):5'- AACACAAAAGCCTGTCTCTAGATG -3'

Sequencing Primer
(F):5'- CCAGTACAGGGGAACGCCAG -3'
(R):5'- AAAAGCCTGTCTCTAGATGTTGCC -3'
Posted On2018-03-15