Incidental Mutation 'R7097:Gm11639'
ID550575
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7097 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105008961 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 4350 (I4350F)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212287
AA Change: I4350F

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,220 N435S probably damaging Het
Aip A T 19: 4,115,381 V195E probably benign Het
Amer3 A T 1: 34,588,788 I703F probably benign Het
Amfr T C 8: 94,012,009 E7G probably benign Het
Angel1 A G 12: 86,726,384 S4P probably damaging Het
Atp2c1 A G 9: 105,464,651 I146T probably damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Bahcc1 T C 11: 120,272,646 V590A possibly damaging Het
Bcl6 A G 16: 23,972,614 V330A possibly damaging Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Btaf1 C T 19: 36,949,102 T58I probably damaging Het
Ccdc175 A T 12: 72,128,409 probably null Het
Cdca4 C A 12: 112,821,569 V180L probably benign Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Clec4g T A 8: 3,719,518 T42S possibly damaging Het
Ctsg A C 14: 56,100,032 I238S probably damaging Het
Cyb5rl A T 4: 107,087,316 E41V unknown Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Dnaaf1 G T 8: 119,596,799 G509V possibly damaging Het
Dnah5 A G 15: 28,453,264 I4394V probably benign Het
Dot1l T G 10: 80,790,726 S1260R probably damaging Het
Dst T G 1: 34,169,260 I1089S probably damaging Het
Eps8l3 A G 3: 107,884,485 probably null Het
Fam135b A G 15: 71,622,068 V4A possibly damaging Het
Fnip2 T C 3: 79,481,006 E806G probably benign Het
Fryl T A 5: 73,073,908 I1609F probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gsn A T 2: 35,295,049 K339* probably null Het
Hecw2 T A 1: 53,865,124 Y1155F possibly damaging Het
Kif20b T A 19: 34,974,492 N1723K probably damaging Het
Kif2b T C 11: 91,576,824 D211G probably benign Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Med16 C T 10: 79,903,343 G203D probably damaging Het
Mrgpra3 T A 7: 47,589,641 Y179F probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo18b A G 5: 112,874,405 S374P unknown Het
Myoz1 A G 14: 20,649,409 I287T possibly damaging Het
Ncoa6 T C 2: 155,438,063 D11G probably benign Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nmur1 T C 1: 86,387,508 T212A probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G T 2: 36,734,424 M34I probably benign Het
Olfr54 C A 11: 51,027,601 L200I probably benign Het
Olfr891 A T 9: 38,180,336 C162* probably null Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pear1 T G 3: 87,751,445 H901P probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pip5k1b T G 19: 24,358,060 E362D probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Pole T A 5: 110,325,102 probably null Het
Prdm16 G T 4: 154,345,468 T348K probably damaging Het
Prkdc T A 16: 15,689,343 F896I probably damaging Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Ptpn14 G A 1: 189,863,398 W739* probably null Het
Rfx5 G T 3: 94,956,539 G135C probably damaging Het
Scmh1 A G 4: 120,525,055 H573R probably benign Het
Serpina5 G T 12: 104,102,295 probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Slc6a17 C G 3: 107,493,148 G222R probably damaging Het
Sp110 C T 1: 85,579,685 G367D possibly damaging Het
Srcap C A 7: 127,539,041 L1128M probably damaging Het
Tmem189 C G 2: 167,661,478 A7P probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trav6-4 A T 14: 53,454,592 Y52F probably benign Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Trub2 A G 2: 29,779,826 V177A possibly damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Wnk2 C A 13: 49,102,838 R269L possibly damaging Het
Zc3h12c T A 9: 52,115,926 Q731L possibly damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site unknown
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTCTCCTCAGAGTGAAAGACA -3'
(R):5'- CCCTAGTACACAGTCAATACCAG -3'

Sequencing Primer
(F):5'- CTCCTCAGAGTGAAAGACAAATGTTC -3'
(R):5'- CAGTCAATACCAGAAGACAAAATTTG -3'
Posted On2019-05-15