Incidental Mutation 'R6269:Prc1'
ID507220
Institutional Source Beutler Lab
Gene Symbol Prc1
Ensembl Gene ENSMUSG00000038943
Gene Nameprotein regulator of cytokinesis 1
SynonymsD7Ertd348e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6269 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80294450-80316259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80309427 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 381 (R381Q)
Ref Sequence ENSEMBL: ENSMUSP00000133910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047558] [ENSMUST00000163812] [ENSMUST00000172781] [ENSMUST00000173824] [ENSMUST00000174172] [ENSMUST00000174199]
Predicted Effect probably damaging
Transcript: ENSMUST00000047558
AA Change: R381Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043379
Gene: ENSMUSG00000038943
AA Change: R381Q

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.45e-5 PROSPERO
Pfam:MAP65_ASE1 37 602 5.3e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130888
Predicted Effect probably damaging
Transcript: ENSMUST00000163812
AA Change: R381Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129675
Gene: ENSMUSG00000038943
AA Change: R381Q

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.51e-5 PROSPERO
Pfam:MAP65_ASE1 37 605 1.9e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172781
SMART Domains Protein: ENSMUSP00000133618
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 150 2.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172911
Predicted Effect probably benign
Transcript: ENSMUST00000173170
SMART Domains Protein: ENSMUSP00000133817
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 189 2.1e-64 PFAM
Pfam:MAP65_ASE1 187 235 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173824
AA Change: R381Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133910
Gene: ENSMUSG00000038943
AA Change: R381Q

DomainStartEndE-ValueType
internal_repeat_1 22 36 8.71e-6 PROSPERO
Pfam:MAP65_ASE1 37 565 6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173914
Predicted Effect unknown
Transcript: ENSMUST00000174051
AA Change: R10Q
SMART Domains Protein: ENSMUSP00000134262
Gene: ENSMUSG00000038943
AA Change: R10Q

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 244 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174111
Predicted Effect probably damaging
Transcript: ENSMUST00000174172
AA Change: R381Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133387
Gene: ENSMUSG00000038943
AA Change: R381Q

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 34 615 2.9e-167 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174199
AA Change: R340Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133295
Gene: ENSMUSG00000038943
AA Change: R340Q

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 7 524 8.1e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174254
Predicted Effect probably benign
Transcript: ENSMUST00000174599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206178
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,964,051 I609N unknown Het
Ano10 A T 9: 122,261,242 I277N probably damaging Het
Ap2b1 A G 11: 83,346,673 D483G probably damaging Het
As3mt T A 19: 46,719,952 F226Y probably damaging Het
Atp10a G A 7: 58,803,739 R855H possibly damaging Het
Bin3 T A 14: 70,137,162 H213Q probably benign Het
Bora T C 14: 99,073,667 C512R probably damaging Het
Camk2b T A 11: 5,978,497 D414V probably damaging Het
Ccdc27 A T 4: 154,037,722 L233Q unknown Het
Ccdc73 T C 2: 104,907,633 S25P probably damaging Het
Cenpf G A 1: 189,659,920 H572Y probably benign Het
Chil4 A G 3: 106,204,171 V209A probably damaging Het
Clstn1 T C 4: 149,644,067 V650A probably benign Het
Cox6a2 T A 7: 128,206,265 S11C probably benign Het
Csf1 T C 3: 107,749,001 E238G probably benign Het
Cyp2c23 T A 19: 44,029,187 M1L unknown Het
Cyp4a10 T A 4: 115,524,312 M191K probably damaging Het
Cyp4a14 A G 4: 115,491,131 V383A possibly damaging Het
D130052B06Rik T G 11: 33,623,916 V171G possibly damaging Het
Dlgap2 A G 8: 14,822,369 T617A probably benign Het
Dyrk4 T A 6: 126,886,727 I351F probably damaging Het
Epg5 T C 18: 77,948,370 V94A probably benign Het
Fam111a A G 19: 12,588,443 T519A probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Gdpd4 A G 7: 97,974,462 S314G probably damaging Het
Gm9758 T A 5: 14,912,260 K111N possibly damaging Het
Gpr137b A T 13: 13,363,511 V285E probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itgal T A 7: 127,330,217 L1102Q probably null Het
Kctd19 T A 8: 105,395,360 Y185F possibly damaging Het
Kif5b A G 18: 6,223,558 L317P possibly damaging Het
Klhl42 C A 6: 147,092,307 A259E probably damaging Het
Lrrc2 A G 9: 110,980,949 D351G probably damaging Het
Med12l A G 3: 59,227,822 E797G probably damaging Het
Mink1 A G 11: 70,598,987 E63G probably damaging Het
Nek9 T C 12: 85,332,329 probably null Het
Olfr1120 A T 2: 87,846,874 H201L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp6 G A 9: 59,650,012 V627I probably benign Het
Pclo C T 5: 14,522,094 Q498* probably null Het
Pdlim5 T C 3: 142,312,325 T170A possibly damaging Het
Pgap1 A T 1: 54,548,008 Y136* probably null Het
Pgghg T A 7: 140,946,184 N563K probably damaging Het
Plxnb2 A G 15: 89,160,713 M1143T probably benign Het
Pnpla1 G A 17: 28,881,368 G403E probably benign Het
Psph A T 5: 129,766,465 I175N probably damaging Het
Rbbp8nl T A 2: 180,281,512 K131* probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Sde2 G A 1: 180,855,806 V42I probably benign Het
Slc25a3 G A 10: 91,117,101 R314* probably null Het
Spag9 A G 11: 94,044,507 N48S probably benign Het
Srp54b T C 12: 55,255,972 M351T possibly damaging Het
Tcaf2 A G 6: 42,627,408 L679P probably damaging Het
Tnrc6b T A 15: 80,880,743 N815K probably benign Het
Usp17la A T 7: 104,860,350 Q54L possibly damaging Het
Vmn2r92 T A 17: 18,166,774 I125K probably benign Het
Xrra1 T C 7: 99,917,472 Y732H probably damaging Het
Zfp131 A G 13: 119,766,405 S603P possibly damaging Het
Zfp28 G T 7: 6,393,613 S349I probably benign Het
Other mutations in Prc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Prc1 APN 7 80307696 critical splice donor site probably null
IGL02342:Prc1 APN 7 80309442 missense probably damaging 1.00
IGL03058:Prc1 APN 7 80301125 missense probably benign 0.05
R0026:Prc1 UTSW 7 80311061 unclassified probably benign
R0315:Prc1 UTSW 7 80313536 missense probably damaging 0.99
R0453:Prc1 UTSW 7 80313102 missense probably damaging 1.00
R2101:Prc1 UTSW 7 80312284 missense probably benign 0.38
R2857:Prc1 UTSW 7 80312221 missense probably damaging 0.99
R4237:Prc1 UTSW 7 80311216 unclassified probably benign
R4238:Prc1 UTSW 7 80311216 unclassified probably benign
R4240:Prc1 UTSW 7 80311216 unclassified probably benign
R4300:Prc1 UTSW 7 80311216 unclassified probably benign
R4745:Prc1 UTSW 7 80313163 missense probably benign 0.10
R5227:Prc1 UTSW 7 80313179 missense probably damaging 1.00
R5574:Prc1 UTSW 7 80294542 unclassified probably benign
R6174:Prc1 UTSW 7 80304796 missense probably benign 0.02
R7060:Prc1 UTSW 7 80304373 missense probably benign 0.00
R7201:Prc1 UTSW 7 80311089 missense possibly damaging 0.65
R7266:Prc1 UTSW 7 80307657 missense possibly damaging 0.78
R7491:Prc1 UTSW 7 80309491 splice site probably null
R7498:Prc1 UTSW 7 80313150 missense possibly damaging 0.83
R7528:Prc1 UTSW 7 80300435 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAGAAGTGATCGGTGTCT -3'
(R):5'- TGTGGCAGCCTTAGCAAACT -3'

Sequencing Primer
(F):5'- TGGAACTCACTGTAAACCTGGCTG -3'
(R):5'- GTGGCAGCCTTAGCAAACTATGATAC -3'
Posted On2018-03-15