Incidental Mutation 'R3522:Sntg2'
ID267566
Institutional Source Beutler Lab
Gene Symbol Sntg2
Ensembl Gene ENSMUSG00000020672
Gene Namesyntrophin, gamma 2
Synonyms2210008K22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location30174482-30373375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30312567 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 60 (V60A)
Ref Sequence ENSEMBL: ENSMUSP00000115942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021004] [ENSMUST00000133324] [ENSMUST00000142046] [ENSMUST00000149710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021004
AA Change: V60A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021004
Gene: ENSMUSG00000020672
AA Change: V60A

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
PH 297 423 7.66e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125530
Predicted Effect possibly damaging
Transcript: ENSMUST00000133324
AA Change: V60A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114245
Gene: ENSMUSG00000020672
AA Change: V60A

DomainStartEndE-ValueType
Blast:PH 13 70 9e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000142046
AA Change: V60A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115942
Gene: ENSMUSG00000020672
AA Change: V60A

DomainStartEndE-ValueType
Blast:PH 13 89 1e-23 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000149710
AA Change: V60A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123332
Gene: ENSMUSG00000020672
AA Change: V60A

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218723
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that bind to components of mechanosenstive sodium channels and the extreme carboxy-terminal domain of dystrophin and dystrophin-related proteins. The PDZ domain of this protein product interacts with a protein component of a mechanosensitive sodium channel that affects channel gating. Absence or reduction of this protein product has been associated with Duchenne muscular dystrophy. There is evidence of alternative splicing yet the full-length nature of these variants has not been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Sntg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sntg2 APN 12 30276721 missense probably benign 0.08
IGL00914:Sntg2 APN 12 30257957 intron probably benign
IGL00950:Sntg2 APN 12 30312681 splice site probably benign
IGL01106:Sntg2 APN 12 30257988 nonsense probably null
IGL01732:Sntg2 APN 12 30312649 missense probably damaging 0.99
IGL01987:Sntg2 APN 12 30312570 missense probably damaging 1.00
IGL02138:Sntg2 APN 12 30307231 critical splice acceptor site probably null
IGL02325:Sntg2 APN 12 30195543 missense probably benign 0.08
IGL02619:Sntg2 APN 12 30267026 splice site probably null
IGL02797:Sntg2 APN 12 30226892 missense possibly damaging 0.93
IGL03176:Sntg2 APN 12 30267023 splice site probably benign
R0126:Sntg2 UTSW 12 30201261 splice site probably benign
R0309:Sntg2 UTSW 12 30226773 missense probably benign 0.03
R0614:Sntg2 UTSW 12 30257978 missense possibly damaging 0.87
R1267:Sntg2 UTSW 12 30245128 missense probably benign 0.42
R1546:Sntg2 UTSW 12 30288296 missense probably damaging 1.00
R1696:Sntg2 UTSW 12 30267063 missense probably damaging 1.00
R1708:Sntg2 UTSW 12 30373180 missense possibly damaging 0.81
R1867:Sntg2 UTSW 12 30236651 missense probably benign
R2256:Sntg2 UTSW 12 30236688 nonsense probably null
R2895:Sntg2 UTSW 12 30226846 missense probably benign 0.00
R3401:Sntg2 UTSW 12 30288172 splice site probably benign
R4771:Sntg2 UTSW 12 30276659 splice site probably null
R4814:Sntg2 UTSW 12 30373268 unclassified probably benign
R5554:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R6056:Sntg2 UTSW 12 30312561 missense probably benign 0.06
R6328:Sntg2 UTSW 12 30258014 missense probably damaging 1.00
R6373:Sntg2 UTSW 12 30258041 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGTAATGTACTCAGCTGGTACTTG -3'
(R):5'- AGAAATGTATGTGCACAGGTTAGC -3'

Sequencing Primer
(F):5'- ATGTACTCAGCTGGTACTTGTAGAC -3'
(R):5'- TATGTGCACAGGTTAGCAGGTAG -3'
Posted On2015-02-18