Incidental Mutation 'R6408:Gjb5'
ID514524
Institutional Source Beutler Lab
Gene Symbol Gjb5
Ensembl Gene ENSMUSG00000042357
Gene Namegap junction protein, beta 5
Synonymsconnexin 31.1, Gjb-5, Cx31.1, Cnx31.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127354809-127358181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127356147 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 68 (F68Y)
Ref Sequence ENSEMBL: ENSMUSP00000045325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046498] [ENSMUST00000060419] [ENSMUST00000106090]
Predicted Effect probably benign
Transcript: ENSMUST00000046498
AA Change: F68Y

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045325
Gene: ENSMUSG00000042357
AA Change: F68Y

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
CNX 42 75 1.99e-19 SMART
Connexin_CCC 139 206 1.42e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060419
SMART Domains Protein: ENSMUSP00000053307
Gene: ENSMUSG00000046623

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 9.16e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 208 6.28e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106090
SMART Domains Protein: ENSMUSP00000101696
Gene: ENSMUSG00000046623

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
CNX 42 75 9.16e-19 SMART
low complexity region 98 103 N/A INTRINSIC
Connexin_CCC 141 208 6.28e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-type (group I) connexin family. The encoded protein is a gap junction protein involved in intercellular communication related to epidermal differentiation and environmental sensing. This gene has been linked to non-small cell lung cancer. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, reduced weight and reduced placental development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Gjb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Gjb5 APN 4 127355562 missense probably benign 0.03
IGL03376:Gjb5 APN 4 127356255 missense probably damaging 1.00
PIT4508001:Gjb5 UTSW 4 127356240 missense probably damaging 0.99
R2090:Gjb5 UTSW 4 127356001 missense probably benign 0.01
R2197:Gjb5 UTSW 4 127356270 unclassified probably null
R4968:Gjb5 UTSW 4 127356222 missense probably damaging 1.00
R5419:Gjb5 UTSW 4 127355859 missense probably benign
R5494:Gjb5 UTSW 4 127355554 missense probably damaging 0.99
R5664:Gjb5 UTSW 4 127355929 missense probably benign 0.00
R5806:Gjb5 UTSW 4 127355925 missense probably benign
R6369:Gjb5 UTSW 4 127355930 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TATGTCCACCAGAGTCCACC -3'
(R):5'- CCCTTGAGTCCACCATGAAC -3'

Sequencing Primer
(F):5'- AGAGTCCACCCCGCTTC -3'
(R):5'- CATGAACTGGAGTGTTTTTGAGGGAC -3'
Posted On2018-05-04