Incidental Mutation 'R6408:Hs6st3'
ID514555
Institutional Source Beutler Lab
Gene Symbol Hs6st3
Ensembl Gene ENSMUSG00000053465
Gene Nameheparan sulfate 6-O-sulfotransferase 3
Synonyms6OST3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R6408 (G1)
Quality Score193.009
Status Validated
Chromosome14
Chromosomal Location119138341-119869815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119138634 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 74 (P74T)
Ref Sequence ENSEMBL: ENSMUSP00000070394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065904]
Predicted Effect probably benign
Transcript: ENSMUST00000065904
AA Change: P74T

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070394
Gene: ENSMUSG00000053465
AA Change: P74T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 86 115 N/A INTRINSIC
Pfam:Sulfotransfer_2 137 410 4.7e-83 PFAM
low complexity region 425 447 N/A INTRINSIC
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate (HS) sulfotransferases, such as HS6ST3, modify HS to generate structures required for interactions between HS and a variety of proteins. These interactions are implicated in proliferation and differentiation, adhesion, migration, inflammation, blood coagulation, and other diverse processes (Habuchi et al., 2000 [PubMed 10644753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Hs6st3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Hs6st3 APN 14 119139034 missense probably damaging 1.00
IGL00973:Hs6st3 APN 14 119869407 missense possibly damaging 0.58
IGL02185:Hs6st3 APN 14 119868884 critical splice acceptor site probably null
IGL02696:Hs6st3 APN 14 119869319 missense probably damaging 0.98
IGL02820:Hs6st3 APN 14 119139080 missense possibly damaging 0.95
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0634:Hs6st3 UTSW 14 119869062 nonsense probably null
R0737:Hs6st3 UTSW 14 119869383 missense possibly damaging 0.82
R0750:Hs6st3 UTSW 14 119138707 small deletion probably benign
R1975:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R1977:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R2025:Hs6st3 UTSW 14 119869389 missense probably damaging 1.00
R2116:Hs6st3 UTSW 14 119869287 missense probably damaging 1.00
R2295:Hs6st3 UTSW 14 119138445 missense probably benign 0.15
R3154:Hs6st3 UTSW 14 119868977 missense probably damaging 0.99
R5700:Hs6st3 UTSW 14 119138787 nonsense probably null
R5744:Hs6st3 UTSW 14 119138440 missense possibly damaging 0.96
R5852:Hs6st3 UTSW 14 119869326 missense probably damaging 1.00
R5861:Hs6st3 UTSW 14 119138853 missense possibly damaging 0.89
R6262:Hs6st3 UTSW 14 119138991 missense possibly damaging 0.95
R7140:Hs6st3 UTSW 14 119139102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGTGGTCATCATGTACCAG -3'
(R):5'- GATGTGCAGGAACACGATCAC -3'

Sequencing Primer
(F):5'- ATGTACCAGTACGTGTCCCC -3'
(R):5'- CCCTTTGATGTTGAAGTCCACGAAG -3'
Posted On2018-05-04