Incidental Mutation 'R6473:Olfr191'
ID520368
Institutional Source Beutler Lab
Gene Symbol Olfr191
Ensembl Gene ENSMUSG00000094539
Gene Nameolfactory receptor 191
SynonymsGA_x54KRFPKG5P-55314632-55313703, MOR183-5P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6473 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59082829-59089822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59086043 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 147 (L147M)
Ref Sequence ENSEMBL: ENSMUSP00000150473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078517] [ENSMUST00000215647]
Predicted Effect probably benign
Transcript: ENSMUST00000078517
AA Change: L147M

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077604
Gene: ENSMUSG00000094539
AA Change: L147M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-47 PFAM
Pfam:7tm_1 41 290 6.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215647
AA Change: L147M

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Olfr191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr191 APN 16 59086393 missense possibly damaging 0.86
IGL01553:Olfr191 APN 16 59086322 missense probably benign 0.35
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R0233:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R1367:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R1631:Olfr191 UTSW 16 59086045 missense probably benign
R1660:Olfr191 UTSW 16 59086343 missense probably benign 0.00
R2166:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2167:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2168:Olfr191 UTSW 16 59085586 missense probably benign 0.07
R2191:Olfr191 UTSW 16 59085675 missense probably benign 0.01
R3836:Olfr191 UTSW 16 59086223 missense possibly damaging 0.61
R4999:Olfr191 UTSW 16 59086402 missense probably damaging 1.00
R5386:Olfr191 UTSW 16 59085890 missense probably benign
R5589:Olfr191 UTSW 16 59085971 missense probably benign 0.03
R5590:Olfr191 UTSW 16 59085997 missense probably benign 0.06
R5609:Olfr191 UTSW 16 59086076 missense possibly damaging 0.96
R5965:Olfr191 UTSW 16 59086303 missense probably damaging 1.00
R5989:Olfr191 UTSW 16 59086334 missense probably benign 0.00
R6049:Olfr191 UTSW 16 59086146 nonsense probably null
R6058:Olfr191 UTSW 16 59085910 missense probably damaging 0.99
R6058:Olfr191 UTSW 16 59086429 missense probably benign
R6250:Olfr191 UTSW 16 59085832 missense probably damaging 1.00
R6319:Olfr191 UTSW 16 59086021 missense probably benign 0.08
R6524:Olfr191 UTSW 16 59086277 missense possibly damaging 0.76
R6748:Olfr191 UTSW 16 59085890 missense probably benign
R6874:Olfr191 UTSW 16 59085949 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGAAGACCTGAATTGAGCC -3'
(R):5'- GTGACACCAAAGATGCTACAAG -3'

Sequencing Primer
(F):5'- TTGAGCCAGAGAAAATAAAGAGCATC -3'
(R):5'- TTTCCAAGAGTAAACTGATCTCTTTC -3'
Posted On2018-06-06