Incidental Mutation 'R6529:Wdr46'
ID522229
Institutional Source Beutler Lab
Gene Symbol Wdr46
Ensembl Gene ENSMUSG00000024312
Gene NameWD repeat domain 46
SynonymsBing4, 2310007I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6529 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33940660-33949695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33949146 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 564 (L564Q)
Ref Sequence ENSEMBL: ENSMUSP00000025170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025170] [ENSMUST00000087543] [ENSMUST00000174609]
Predicted Effect probably benign
Transcript: ENSMUST00000008812
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000025170
AA Change: L564Q

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312
AA Change: L564Q

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087543
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Predicted Effect probably benign
Transcript: ENSMUST00000174609
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A T 7: 79,089,731 M296L probably benign Het
Atxn2 T C 5: 121,811,614 probably null Het
B3galnt2 G T 13: 13,995,792 R242S probably benign Het
Casz1 G A 4: 148,938,189 E571K probably damaging Het
Ccdc163 A G 4: 116,708,924 probably null Het
Cd109 A G 9: 78,712,625 D1383G probably damaging Het
Cd200r1 A G 16: 44,789,702 T95A possibly damaging Het
Chd2 T C 7: 73,503,443 E219G possibly damaging Het
Dnah14 T A 1: 181,666,469 V1730D probably damaging Het
Eps8 G A 6: 137,514,337 H348Y possibly damaging Het
Fam92a A G 4: 12,168,978 V175A probably damaging Het
Fbxo2 A T 4: 148,165,054 D187V probably damaging Het
Fsip2 A T 2: 82,982,313 Y2992F probably benign Het
Gle1 A T 2: 29,935,527 T10S possibly damaging Het
Got2 T C 8: 95,888,385 probably benign Het
Gtf3c6 T C 10: 40,251,255 T34A probably benign Het
Hist1h4j G T 13: 21,735,306 V71F possibly damaging Het
Klf15 C T 6: 90,467,412 T323I probably damaging Het
Krtap5-3 C A 7: 142,202,342 C305* probably null Het
Map2k6 A T 11: 110,492,562 D99V probably damaging Het
Nckap5l G T 15: 99,426,594 P676Q probably benign Het
Nup188 A T 2: 30,326,454 T757S possibly damaging Het
Olfr1337 C T 4: 118,781,710 V292I probably benign Het
Olfr638 T C 7: 104,003,926 V217A probably benign Het
Peg3 C A 7: 6,708,072 A1384S probably damaging Het
Plekho2 C T 9: 65,573,101 R14H probably benign Het
Qsox2 A T 2: 26,217,741 C247S probably damaging Het
Slc25a13 A G 6: 6,073,451 V469A probably benign Het
Slitrk3 T C 3: 73,051,218 T74A probably benign Het
Spata48 T C 11: 11,515,009 F120S possibly damaging Het
Sult1a1 T C 7: 126,675,138 T91A probably benign Het
Sult3a2 T C 10: 33,779,737 Y82C probably damaging Het
Taf1b A T 12: 24,556,651 H490L possibly damaging Het
Trrap T A 5: 144,834,204 H2804Q probably benign Het
Uhrf1bp1 A G 17: 27,879,776 I218M possibly damaging Het
Usp8 A G 2: 126,725,378 I106V probably benign Het
Wdcp T A 12: 4,851,143 V333D probably damaging Het
Wrn T C 8: 33,335,976 probably null Het
Zfp664 C T 5: 124,886,288 H249Y probably damaging Het
Zfp975 A C 7: 42,661,901 H429Q possibly damaging Het
Other mutations in Wdr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0147:Wdr46 UTSW 17 33941023 missense probably benign
R0148:Wdr46 UTSW 17 33941023 missense probably benign
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R2085:Wdr46 UTSW 17 33941451 nonsense probably null
R4319:Wdr46 UTSW 17 33940744 missense probably benign 0.04
R4368:Wdr46 UTSW 17 33941146 unclassified probably benign
R4831:Wdr46 UTSW 17 33941836 missense probably benign 0.17
R4831:Wdr46 UTSW 17 33949399 unclassified probably benign
R5118:Wdr46 UTSW 17 33948837 missense possibly damaging 0.65
R6211:Wdr46 UTSW 17 33944485 missense probably damaging 1.00
R6347:Wdr46 UTSW 17 33941852 missense probably damaging 1.00
R7318:Wdr46 UTSW 17 33941885 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGACTGGTATGGAGCCAC -3'
(R):5'- TCTATCCAGTGCAGAGGGAC -3'

Sequencing Primer
(F):5'- CCACCTGCTATGTGCGC -3'
(R):5'- GCATGGCCATATCCTGCTTTTTC -3'
Posted On2018-06-06