Incidental Mutation 'R6753:Gas2l1'
ID530907
Institutional Source Beutler Lab
Gene Symbol Gas2l1
Ensembl Gene ENSMUSG00000034201
Gene Namegrowth arrest-specific 2 like 1
Synonyms4930500E24Rik, D0Jmb1, TU-71.1, GAR22
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6753 (G1)
Quality Score165.009
Status Validated
Chromosome11
Chromosomal Location5054132-5065327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5064254 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 69 (V69I)
Ref Sequence ENSEMBL: ENSMUSP00000105521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037146] [ENSMUST00000037218] [ENSMUST00000056649] [ENSMUST00000109895] [ENSMUST00000152257]
Predicted Effect probably damaging
Transcript: ENSMUST00000037146
AA Change: V69I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043709
Gene: ENSMUSG00000034201
AA Change: V69I

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037218
SMART Domains Protein: ENSMUSP00000048453
Gene: ENSMUSG00000034209

DomainStartEndE-ValueType
Pfam:Ras 6 180 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056649
AA Change: V69I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050275
Gene: ENSMUSG00000034201
AA Change: V69I

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109895
AA Change: V69I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105521
Gene: ENSMUSG00000034201
AA Change: V69I

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
GAS2 206 278 7.69e-52 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 335 365 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 460 473 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 509 539 N/A INTRINSIC
low complexity region 546 568 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151936
Predicted Effect possibly damaging
Transcript: ENSMUST00000152257
AA Change: V69I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121993
Gene: ENSMUSG00000034201
AA Change: V69I

DomainStartEndE-ValueType
CH 29 143 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156196
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the Gas2 family, actin-associated proteins expressed at high levels in growth-arrested cells. The gene expression is negatively regulated by serum and growth factors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Gas2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0060:Gas2l1 UTSW 11 5062319 unclassified probably benign
R1606:Gas2l1 UTSW 11 5064434 missense probably damaging 1.00
R1719:Gas2l1 UTSW 11 5064266 missense probably damaging 1.00
R1934:Gas2l1 UTSW 11 5061408 missense probably benign 0.00
R4426:Gas2l1 UTSW 11 5063908 missense probably benign
R4427:Gas2l1 UTSW 11 5063908 missense probably benign
R4705:Gas2l1 UTSW 11 5060867 missense possibly damaging 0.71
R4811:Gas2l1 UTSW 11 5064436 missense probably damaging 1.00
R4817:Gas2l1 UTSW 11 5061429 missense possibly damaging 0.73
R4847:Gas2l1 UTSW 11 5064173 missense probably damaging 1.00
R5212:Gas2l1 UTSW 11 5061108 missense probably benign 0.24
R7134:Gas2l1 UTSW 11 5061106 nonsense probably null
R7293:Gas2l1 UTSW 11 5064338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTCAAACATGAGCACTTC -3'
(R):5'- TATGTCCCCACAGTGACTCC -3'

Sequencing Primer
(F):5'- ATGAGCACTTCAGGCACG -3'
(R):5'- TGACTCCACTGGCTCTGG -3'
Posted On2018-08-01