Incidental Mutation 'R6767:Plch1'
ID531958
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Namephospholipase C, eta 1
SynonymsPLCeta1, Plcl3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6767 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location63696234-63899472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63755344 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 246 (M246K)
Ref Sequence ENSEMBL: ENSMUSP00000124463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]
Predicted Effect probably damaging
Transcript: ENSMUST00000048134
AA Change: M228K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: M228K

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059973
AA Change: M246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: M246K

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084105
AA Change: M246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: M246K

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159676
AA Change: M246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: M246K

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160638
AA Change: M246K

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: M246K

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162269
AA Change: M246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: M246K

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000175947
AA Change: M246K
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: M246K

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177143
AA Change: M258K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: M258K

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63731729 splice site probably null
IGL01542:Plch1 APN 3 63731649 missense probably damaging 0.99
IGL01999:Plch1 APN 3 63753307 missense probably damaging 1.00
IGL02153:Plch1 APN 3 63781351 missense probably damaging 1.00
IGL02203:Plch1 APN 3 63698739 missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63698961 missense probably damaging 0.97
IGL02259:Plch1 APN 3 63722749 critical splice donor site probably null
IGL02268:Plch1 APN 3 63699283 makesense probably null
IGL02411:Plch1 APN 3 63697756 unclassified probably null
IGL02472:Plch1 APN 3 63701849 missense probably damaging 1.00
IGL02477:Plch1 APN 3 63753293 missense probably damaging 1.00
IGL02503:Plch1 APN 3 63697864 missense probably damaging 1.00
IGL02800:Plch1 APN 3 63698478 missense probably benign 0.21
IGL03167:Plch1 APN 3 63722744 splice site probably benign
IGL03182:Plch1 APN 3 63702594 nonsense probably null
IGL03197:Plch1 APN 3 63753170 missense probably damaging 1.00
IGL03251:Plch1 APN 3 63784002 missense possibly damaging 0.93
R0335:Plch1 UTSW 3 63710978 missense probably damaging 1.00
R0347:Plch1 UTSW 3 63753316 missense probably damaging 1.00
R0631:Plch1 UTSW 3 63699219 missense probably benign 0.23
R0687:Plch1 UTSW 3 63716029 missense probably damaging 1.00
R0738:Plch1 UTSW 3 63702553 intron probably benign
R0883:Plch1 UTSW 3 63753256 missense probably damaging 1.00
R1437:Plch1 UTSW 3 63697533 missense probably benign 0.37
R1678:Plch1 UTSW 3 63740694 missense probably damaging 1.00
R1738:Plch1 UTSW 3 63719238 missense probably benign 0.12
R1929:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R1955:Plch1 UTSW 3 63755267 missense probably damaging 0.98
R2078:Plch1 UTSW 3 63701943 missense probably benign 0.01
R2112:Plch1 UTSW 3 63722806 missense probably damaging 1.00
R2158:Plch1 UTSW 3 63721234 missense probably benign 0.00
R2165:Plch1 UTSW 3 63698482 missense probably benign 0.01
R2259:Plch1 UTSW 3 63697977 missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R3110:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3112:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3407:Plch1 UTSW 3 63699347 unclassified probably benign
R3408:Plch1 UTSW 3 63699347 unclassified probably benign
R3791:Plch1 UTSW 3 63699523 missense probably benign
R3793:Plch1 UTSW 3 63697831 missense probably damaging 0.96
R3928:Plch1 UTSW 3 63767623 missense probably damaging 1.00
R4211:Plch1 UTSW 3 63711219 missense probably damaging 1.00
R4212:Plch1 UTSW 3 63870759 start gained probably benign
R4223:Plch1 UTSW 3 63701900 missense probably damaging 1.00
R4491:Plch1 UTSW 3 63740739 missense probably damaging 1.00
R4589:Plch1 UTSW 3 63781507 missense probably damaging 1.00
R4656:Plch1 UTSW 3 63704177 missense probably damaging 1.00
R4701:Plch1 UTSW 3 63699496 intron probably null
R4716:Plch1 UTSW 3 63781546 missense probably damaging 1.00
R4772:Plch1 UTSW 3 63753325 missense probably damaging 1.00
R4902:Plch1 UTSW 3 63740843 intron probably benign
R5058:Plch1 UTSW 3 63722781 missense probably damaging 1.00
R5092:Plch1 UTSW 3 63698710 missense probably benign 0.02
R5093:Plch1 UTSW 3 63773715 missense probably damaging 0.99
R5210:Plch1 UTSW 3 63699778 critical splice donor site probably null
R5368:Plch1 UTSW 3 63701973 missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5374:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5501:Plch1 UTSW 3 63707741 missense probably damaging 1.00
R5606:Plch1 UTSW 3 63740687 missense probably benign 0.35
R5738:Plch1 UTSW 3 63773655 missense probably damaging 1.00
R5835:Plch1 UTSW 3 63697522 missense probably benign
R6106:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6107:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6108:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6110:Plch1 UTSW 3 63698858 missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6147:Plch1 UTSW 3 63722881 missense probably damaging 1.00
R6195:Plch1 UTSW 3 63740789 missense probably damaging 1.00
R6315:Plch1 UTSW 3 63781390 nonsense probably null
R6316:Plch1 UTSW 3 63781390 nonsense probably null
R6317:Plch1 UTSW 3 63781390 nonsense probably null
R6318:Plch1 UTSW 3 63781390 nonsense probably null
R6324:Plch1 UTSW 3 63781390 nonsense probably null
R6325:Plch1 UTSW 3 63781390 nonsense probably null
R6326:Plch1 UTSW 3 63781390 nonsense probably null
R6479:Plch1 UTSW 3 63744510 missense probably benign 0.06
R6544:Plch1 UTSW 3 63850978 missense probably damaging 1.00
R6829:Plch1 UTSW 3 63697518 missense probably damaging 0.99
R6891:Plch1 UTSW 3 63698083 missense probably benign
R6893:Plch1 UTSW 3 63753141 nonsense probably null
R6921:Plch1 UTSW 3 63707734 missense possibly damaging 0.90
X0028:Plch1 UTSW 3 63744509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGGGCTTCAACAAATATTTCCC -3'
(R):5'- CTAAAGCTGACAGGTGCCTAGG -3'

Sequencing Primer
(F):5'- CCCATTTTTGCTTCCTAAGAACTG -3'
(R):5'- GGAAGGGTAACATGATAATCACCCTC -3'
Posted On2018-08-29