Incidental Mutation 'R1678:Plch1'
ID188252
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Namephospholipase C, eta 1
SynonymsPLCeta1, Plcl3
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location63696234-63899472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63740694 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 419 (S419P)
Ref Sequence ENSEMBL: ENSMUSP00000124463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048134
AA Change: S401P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: S401P

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000059973
AA Change: S419P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: S419P

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084105
AA Change: S419P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: S419P

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159676
AA Change: S419P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: S419P

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159982
Predicted Effect probably benign
Transcript: ENSMUST00000160638
AA Change: S419P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: S419P

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162269
AA Change: S419P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: S419P

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175947
AA Change: S419P

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: S419P

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177143
AA Change: S431P

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: S431P

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63731729 splice site probably null
IGL01542:Plch1 APN 3 63731649 missense probably damaging 0.99
IGL01999:Plch1 APN 3 63753307 missense probably damaging 1.00
IGL02153:Plch1 APN 3 63781351 missense probably damaging 1.00
IGL02203:Plch1 APN 3 63698739 missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63698961 missense probably damaging 0.97
IGL02259:Plch1 APN 3 63722749 critical splice donor site probably null
IGL02268:Plch1 APN 3 63699283 makesense probably null
IGL02411:Plch1 APN 3 63697756 unclassified probably null
IGL02472:Plch1 APN 3 63701849 missense probably damaging 1.00
IGL02477:Plch1 APN 3 63753293 missense probably damaging 1.00
IGL02503:Plch1 APN 3 63697864 missense probably damaging 1.00
IGL02800:Plch1 APN 3 63698478 missense probably benign 0.21
IGL03167:Plch1 APN 3 63722744 splice site probably benign
IGL03182:Plch1 APN 3 63702594 nonsense probably null
IGL03197:Plch1 APN 3 63753170 missense probably damaging 1.00
IGL03251:Plch1 APN 3 63784002 missense possibly damaging 0.93
R0335:Plch1 UTSW 3 63710978 missense probably damaging 1.00
R0347:Plch1 UTSW 3 63753316 missense probably damaging 1.00
R0631:Plch1 UTSW 3 63699219 missense probably benign 0.23
R0687:Plch1 UTSW 3 63716029 missense probably damaging 1.00
R0738:Plch1 UTSW 3 63702553 intron probably benign
R0883:Plch1 UTSW 3 63753256 missense probably damaging 1.00
R1437:Plch1 UTSW 3 63697533 missense probably benign 0.37
R1738:Plch1 UTSW 3 63719238 missense probably benign 0.12
R1929:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R1955:Plch1 UTSW 3 63755267 missense probably damaging 0.98
R2078:Plch1 UTSW 3 63701943 missense probably benign 0.01
R2112:Plch1 UTSW 3 63722806 missense probably damaging 1.00
R2158:Plch1 UTSW 3 63721234 missense probably benign 0.00
R2165:Plch1 UTSW 3 63698482 missense probably benign 0.01
R2259:Plch1 UTSW 3 63697977 missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R3110:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3112:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3407:Plch1 UTSW 3 63699347 unclassified probably benign
R3408:Plch1 UTSW 3 63699347 unclassified probably benign
R3791:Plch1 UTSW 3 63699523 missense probably benign
R3793:Plch1 UTSW 3 63697831 missense probably damaging 0.96
R3928:Plch1 UTSW 3 63767623 missense probably damaging 1.00
R4211:Plch1 UTSW 3 63711219 missense probably damaging 1.00
R4212:Plch1 UTSW 3 63870759 start gained probably benign
R4223:Plch1 UTSW 3 63701900 missense probably damaging 1.00
R4491:Plch1 UTSW 3 63740739 missense probably damaging 1.00
R4589:Plch1 UTSW 3 63781507 missense probably damaging 1.00
R4656:Plch1 UTSW 3 63704177 missense probably damaging 1.00
R4701:Plch1 UTSW 3 63699496 intron probably null
R4716:Plch1 UTSW 3 63781546 missense probably damaging 1.00
R4772:Plch1 UTSW 3 63753325 missense probably damaging 1.00
R4902:Plch1 UTSW 3 63740843 intron probably benign
R5058:Plch1 UTSW 3 63722781 missense probably damaging 1.00
R5092:Plch1 UTSW 3 63698710 missense probably benign 0.02
R5093:Plch1 UTSW 3 63773715 missense probably damaging 0.99
R5210:Plch1 UTSW 3 63699778 critical splice donor site probably null
R5368:Plch1 UTSW 3 63701973 missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5374:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5501:Plch1 UTSW 3 63707741 missense probably damaging 1.00
R5606:Plch1 UTSW 3 63740687 missense probably benign 0.35
R5738:Plch1 UTSW 3 63773655 missense probably damaging 1.00
R5835:Plch1 UTSW 3 63697522 missense probably benign
R6106:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6107:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6108:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6110:Plch1 UTSW 3 63698858 missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6147:Plch1 UTSW 3 63722881 missense probably damaging 1.00
R6195:Plch1 UTSW 3 63740789 missense probably damaging 1.00
R6315:Plch1 UTSW 3 63781390 nonsense probably null
R6316:Plch1 UTSW 3 63781390 nonsense probably null
R6317:Plch1 UTSW 3 63781390 nonsense probably null
R6318:Plch1 UTSW 3 63781390 nonsense probably null
R6324:Plch1 UTSW 3 63781390 nonsense probably null
R6325:Plch1 UTSW 3 63781390 nonsense probably null
R6326:Plch1 UTSW 3 63781390 nonsense probably null
R6479:Plch1 UTSW 3 63744510 missense probably benign 0.06
R6544:Plch1 UTSW 3 63850978 missense probably damaging 1.00
R6767:Plch1 UTSW 3 63755344 missense probably damaging 1.00
R6829:Plch1 UTSW 3 63697518 missense probably damaging 0.99
R6891:Plch1 UTSW 3 63698083 missense probably benign
R6893:Plch1 UTSW 3 63753141 nonsense probably null
R6921:Plch1 UTSW 3 63707734 missense possibly damaging 0.90
X0028:Plch1 UTSW 3 63744509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCATGGACAGATACCCTTCACACG -3'
(R):5'- TCTCAAGCGTAAGCAACTGCCTC -3'

Sequencing Primer
(F):5'- AGATACCCTTCACACGTATGG -3'
(R):5'- cacacacacacatacacacac -3'
Posted On2014-05-09