Incidental Mutation 'R6788:Klhl29'
ID532512
Institutional Source Beutler Lab
Gene Symbol Klhl29
Ensembl Gene ENSMUSG00000020627
Gene Namekelch-like 29
SynonymsA230106N14Rik, Kbtbd9
MMRRC Submission
Accession Numbers

Genbank: NM_001164493; MGI: 2683857

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location5077472-5375682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5084393 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 673 (V673M)
Ref Sequence ENSEMBL: ENSMUSP00000151284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]
Predicted Effect probably damaging
Transcript: ENSMUST00000020958
AA Change: V734M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: V734M

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 50 75 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
BTB 329 431 2.07e-22 SMART
BACK 436 538 4.88e-32 SMART
Kelch 585 636 5.33e0 SMART
Kelch 637 683 5.42e-5 SMART
Kelch 684 730 5.42e-5 SMART
Kelch 731 778 5.44e-1 SMART
Kelch 779 821 2.54e-1 SMART
Kelch 822 870 4.01e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218384
AA Change: V673M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Tpgs2 T G 18: 25,129,870 N231H probably benign Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Klhl29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Klhl29 APN 12 5140705 missense probably benign 0.01
IGL02639:Klhl29 APN 12 5137453 missense probably damaging 0.96
IGL03142:Klhl29 APN 12 5137603 missense probably damaging 1.00
bauxite UTSW 12 5091347 missense probably damaging 0.98
mineral UTSW 12 5083995 missense probably damaging 0.99
tungsten UTSW 12 5090995 nonsense probably null
N/A - 535:Klhl29 UTSW 12 5084019 missense probably damaging 1.00
R0347:Klhl29 UTSW 12 5084354 missense probably damaging 0.97
R0622:Klhl29 UTSW 12 5081224 missense probably damaging 1.00
R0631:Klhl29 UTSW 12 5094883 missense probably benign 0.08
R0784:Klhl29 UTSW 12 5081251 missense probably damaging 1.00
R1157:Klhl29 UTSW 12 5090650 missense possibly damaging 0.89
R1521:Klhl29 UTSW 12 5091307 missense probably damaging 1.00
R1535:Klhl29 UTSW 12 5084486 missense probably damaging 1.00
R1599:Klhl29 UTSW 12 5093538 missense probably damaging 1.00
R2049:Klhl29 UTSW 12 5137876 missense probably damaging 0.96
R2568:Klhl29 UTSW 12 5091350 missense probably damaging 0.96
R2883:Klhl29 UTSW 12 5084036 missense probably damaging 1.00
R3724:Klhl29 UTSW 12 5090603 missense probably damaging 0.99
R3951:Klhl29 UTSW 12 5140660 missense probably damaging 1.00
R5031:Klhl29 UTSW 12 5091334 missense probably benign 0.05
R5078:Klhl29 UTSW 12 5093530 missense possibly damaging 0.82
R5410:Klhl29 UTSW 12 5091366 missense probably benign 0.36
R5619:Klhl29 UTSW 12 5140587 missense probably benign 0.23
R5681:Klhl29 UTSW 12 5090669 missense possibly damaging 0.56
R6028:Klhl29 UTSW 12 5090995 nonsense probably null
R6294:Klhl29 UTSW 12 5083995 missense probably damaging 0.99
R6394:Klhl29 UTSW 12 5094830 nonsense probably null
R6394:Klhl29 UTSW 12 5137720 missense probably benign 0.00
R6475:Klhl29 UTSW 12 5091030 missense probably damaging 0.98
R6737:Klhl29 UTSW 12 5210124 missense possibly damaging 0.68
R6781:Klhl29 UTSW 12 5091347 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTTTGGGGTTACCTACAGC -3'
(R):5'- CCCATGTCTCCATCTGAAGG -3'

Sequencing Primer
(F):5'- GTTACCTACAGCCCGATGG -3'
(R):5'- GTCTCCATCTGAAGGCTTAAGCTATG -3'
Posted On2018-08-29