Incidental Mutation 'R6788:Tpgs2'
ID532529
Institutional Source Beutler Lab
Gene Symbol Tpgs2
Ensembl Gene ENSMUSG00000024269
Gene Nametubulin polyglutamylase complex subunit 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R6788 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location25127223-25169007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25129870 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 231 (N231H)
Ref Sequence ENSEMBL: ENSMUSP00000122538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097] [ENSMUST00000148255]
Predicted Effect probably benign
Transcript: ENSMUST00000037097
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148255
AA Change: N231H

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269
AA Change: N231H

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.4%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,524,449 V302I probably benign Het
1700016D06Rik T C 8: 11,678,584 E29G possibly damaging Het
Ahctf1 A T 1: 179,752,634 V2001E probably benign Het
Ahsg A G 16: 22,894,835 D122G probably benign Het
Ank3 A G 10: 70,004,723 Y1616C probably damaging Het
Arhgef1 A G 7: 24,919,780 probably null Het
Atp7b T C 8: 22,004,375 I1023V probably benign Het
Bod1l A T 5: 41,821,873 Y699* probably null Het
Car12 C T 9: 66,751,962 S183L probably damaging Het
Cep290 T C 10: 100,488,628 S57P probably damaging Het
Cep57l1 T C 10: 41,743,149 D74G probably damaging Het
Cers6 T C 2: 69,108,559 Y374H possibly damaging Het
Chmp4c T A 3: 10,367,135 M35K possibly damaging Het
Crkl G A 16: 17,483,781 D300N probably damaging Het
Cyp3a41a A G 5: 145,705,829 M240T probably benign Het
Dnah12 G T 14: 26,801,513 L1986F probably damaging Het
Dnah8 T C 17: 30,648,465 I297T probably benign Het
Dock10 T A 1: 80,531,245 I1610F probably damaging Het
Dpys T A 15: 39,857,163 H67L probably damaging Het
Epc2 T G 2: 49,532,087 V331G probably benign Het
Fnbp1l G A 3: 122,546,307 R344* probably null Het
Gm8765 A C 13: 50,703,095 H923P probably damaging Het
Gmip G T 8: 69,811,174 L89F possibly damaging Het
Gmip G C 8: 69,811,176 R90P probably damaging Het
Gpi1 A G 7: 34,228,990 S74P probably damaging Het
Gys1 G A 7: 45,444,678 E406K probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Klhl29 C T 12: 5,084,393 V673M probably damaging Het
Lnpk T C 2: 74,529,676 T332A probably benign Het
Loxl4 T C 19: 42,608,353 D60G probably damaging Het
Lrr1 T C 12: 69,174,675 I197T probably damaging Het
Map1lc3b A G 8: 121,593,577 N43S probably benign Het
Map3k21 A T 8: 125,939,866 D599V probably benign Het
Mastl T C 2: 23,133,698 N338D probably benign Het
Mepe A T 5: 104,338,208 R405* probably null Het
Mrps30 T C 13: 118,380,372 E437G probably benign Het
Mup15 A G 4: 61,438,228 V100A possibly damaging Het
Olfml1 A T 7: 107,567,868 I35F probably damaging Het
Olfml2a T A 2: 38,960,226 Y651* probably null Het
Olfr93 T A 17: 37,151,822 D50V probably damaging Het
Otog T C 7: 46,298,317 V113A probably damaging Het
Parvg C T 15: 84,326,263 L44F possibly damaging Het
Pcnx2 G T 8: 125,772,100 D1553E probably damaging Het
Pcyt2 C T 11: 120,614,374 G122S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Polq C T 16: 37,077,148 T2134I probably damaging Het
Prkce T G 17: 86,630,061 F641V probably damaging Het
Prss1 T C 6: 41,463,720 I243T possibly damaging Het
Pxmp2 A G 5: 110,281,319 F91L probably benign Het
Ralgapb G A 2: 158,436,566 G5R probably damaging Het
Rasgef1a T G 6: 118,087,213 M337R possibly damaging Het
Rassf2 A G 2: 132,002,925 M199T probably damaging Het
Rtbdn A T 8: 84,952,674 Y67F probably null Het
Scamp3 T C 3: 89,181,949 V271A probably benign Het
Sema3a A T 5: 13,597,616 R613W possibly damaging Het
Slc4a3 A T 1: 75,551,315 I206F probably damaging Het
Slc9b1 A G 3: 135,357,757 probably null Het
Smchd1 C A 17: 71,475,101 V22F probably benign Het
Smg1 A G 7: 118,184,571 probably benign Het
Stab1 A G 14: 31,139,160 L89P probably damaging Het
Stim1 A G 7: 102,427,291 E152G probably damaging Het
Tenm3 A G 8: 48,674,493 F50S probably damaging Het
Trank1 T A 9: 111,390,679 N2161K probably damaging Het
Trim28 A G 7: 13,025,346 D129G probably benign Het
Trim66 A T 7: 109,477,754 I326N probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Uggt1 T A 1: 36,230,688 T83S probably benign Het
Wdr91 A G 6: 34,886,819 I587T probably damaging Het
Zpld1 A T 16: 55,232,240 V337D possibly damaging Het
Other mutations in Tpgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Tpgs2 APN 18 25140580 missense possibly damaging 0.93
IGL02184:Tpgs2 APN 18 25140573 missense probably damaging 1.00
IGL02234:Tpgs2 APN 18 25149244 critical splice acceptor site probably null
IGL02747:Tpgs2 APN 18 25139145 intron probably benign
PIT4466001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
PIT4472001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
R0004:Tpgs2 UTSW 18 25158238 splice site probably benign
R0139:Tpgs2 UTSW 18 25149185 missense probably damaging 1.00
R0898:Tpgs2 UTSW 18 25149150 missense probably damaging 1.00
R1415:Tpgs2 UTSW 18 25168553 missense probably damaging 1.00
R1590:Tpgs2 UTSW 18 25140573 missense probably damaging 1.00
R1974:Tpgs2 UTSW 18 25140536 missense probably damaging 1.00
R2144:Tpgs2 UTSW 18 25168541 missense possibly damaging 0.93
R4811:Tpgs2 UTSW 18 25129840 intron probably benign
R4851:Tpgs2 UTSW 18 25151248 missense possibly damaging 0.94
R6386:Tpgs2 UTSW 18 25139024 missense possibly damaging 0.74
R6564:Tpgs2 UTSW 18 25158287 missense probably damaging 0.99
R7112:Tpgs2 UTSW 18 25149137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGGCACAATATCAGTGG -3'
(R):5'- TTCCTCTGGAGAGCAAACTTGC -3'

Sequencing Primer
(F):5'- CCTGTAGGCTTGTAGAACTGTACATC -3'
(R):5'- TGCCCTCTTACATCAGCAGTAGAG -3'
Posted On2018-08-29