Incidental Mutation 'R6948:Mast3'
ID540973
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70785482 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 505 (T505I)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: T521I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T521I

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: T505I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Slc22a14 C A 9: 119,231,416 A93S probably damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACACACATGGGAAATGAGGC -3'
(R):5'- CAACCACAGAGTGAGAGGTC -3'

Sequencing Primer
(F):5'- CACATGGGAAATGAGGCTAGCC -3'
(R):5'- GCCACATGAGCAAGACAGTTTTTG -3'
Posted On2018-11-28