Incidental Mutation 'R6986:Flrt2'
ID542989
Institutional Source Beutler Lab
Gene Symbol Flrt2
Ensembl Gene ENSMUSG00000047414
Gene Namefibronectin leucine rich transmembrane protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location95692226-95785215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95780685 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 599 (I599N)
Ref Sequence ENSEMBL: ENSMUSP00000105744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057324] [ENSMUST00000110117]
PDB Structure
mouse FLRT2 LRR domain in complex with rat Unc5D Ig1 domain [X-RAY DIFFRACTION]
FLRT2 LRR domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000057324
AA Change: I599N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062171
Gene: ENSMUSG00000047414
AA Change: I599N

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110117
AA Change: I599N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105744
Gene: ENSMUSG00000047414
AA Change: I599N

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic, fetal, and postnatel lethality with few mice surviving to weaning due to defects in epicardium, myocardium, and endocardium development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Flrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Flrt2 APN 12 95780529 missense probably damaging 1.00
IGL01083:Flrt2 APN 12 95780347 missense probably benign 0.05
IGL01410:Flrt2 APN 12 95779192 missense probably damaging 1.00
IGL01601:Flrt2 APN 12 95779595 missense probably damaging 0.99
IGL01800:Flrt2 APN 12 95779688 missense probably damaging 1.00
IGL01940:Flrt2 APN 12 95780238 missense probably damaging 1.00
IGL02224:Flrt2 APN 12 95780028 missense possibly damaging 0.58
IGL02272:Flrt2 APN 12 95779704 missense probably damaging 1.00
IGL02452:Flrt2 APN 12 95779483 missense probably benign 0.01
R0966:Flrt2 UTSW 12 95780301 missense possibly damaging 0.70
R1066:Flrt2 UTSW 12 95779059 missense probably damaging 1.00
R1218:Flrt2 UTSW 12 95778953 missense probably benign 0.00
R1442:Flrt2 UTSW 12 95780205 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1746:Flrt2 UTSW 12 95780792 missense possibly damaging 0.90
R1842:Flrt2 UTSW 12 95779284 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779130 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779131 missense probably damaging 1.00
R1959:Flrt2 UTSW 12 95780300 missense probably benign 0.01
R2310:Flrt2 UTSW 12 95780090 missense probably benign 0.01
R3418:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R3419:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R4412:Flrt2 UTSW 12 95780273 missense probably benign
R4617:Flrt2 UTSW 12 95780229 missense possibly damaging 0.96
R4674:Flrt2 UTSW 12 95780688 nonsense probably null
R5001:Flrt2 UTSW 12 95778951 missense probably benign
R5009:Flrt2 UTSW 12 95779773 missense probably damaging 0.98
R5150:Flrt2 UTSW 12 95779203 missense possibly damaging 0.84
R5179:Flrt2 UTSW 12 95780347 missense probably benign 0.05
R5269:Flrt2 UTSW 12 95779938 missense possibly damaging 0.46
R5535:Flrt2 UTSW 12 95780426 missense probably benign 0.08
R6172:Flrt2 UTSW 12 95779531 missense probably damaging 1.00
R6180:Flrt2 UTSW 12 95779238 nonsense probably null
R6867:Flrt2 UTSW 12 95779382 missense probably damaging 1.00
R7379:Flrt2 UTSW 12 95780555 missense possibly damaging 0.68
R7407:Flrt2 UTSW 12 95779300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGCTTCTAGCCATGAG -3'
(R):5'- TGCTCTAGATCTGGCACACTG -3'

Sequencing Primer
(F):5'- GCCATGAGCAGACGACTTC -3'
(R):5'- CTAGATCTGGCACACTGCTGTTG -3'
Posted On2018-11-28