Incidental Mutation 'R7037:Eml4'
ID546798
Institutional Source Beutler Lab
Gene Symbol Eml4
Ensembl Gene ENSMUSG00000032624
Gene Nameechinoderm microtubule associated protein like 4
Synonyms4930443C24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location83350931-83480361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83425327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 136 (D136E)
Ref Sequence ENSEMBL: ENSMUSP00000094528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049503] [ENSMUST00000096766] [ENSMUST00000112363]
Predicted Effect probably benign
Transcript: ENSMUST00000049503
SMART Domains Protein: ENSMUSP00000041880
Gene: ENSMUSG00000032624

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 197 246 1.79e-1 SMART
Blast:WD40 252 294 3e-19 BLAST
WD40 297 336 5.97e-1 SMART
WD40 345 382 2.96e1 SMART
low complexity region 388 396 N/A INTRINSIC
WD40 397 436 1.48e-2 SMART
WD40 480 519 4.95e-4 SMART
WD40 522 560 7.92e1 SMART
WD40 563 602 5.75e-1 SMART
WD40 609 648 2.69e-5 SMART
WD40 722 762 8.04e-4 SMART
low complexity region 793 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096766
AA Change: D136E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000094528
Gene: ENSMUSG00000032624
AA Change: D136E

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
low complexity region 137 155 N/A INTRINSIC
Pfam:HELP 236 308 1.1e-33 PFAM
WD40 309 358 1.79e-1 SMART
Blast:WD40 364 406 4e-20 BLAST
WD40 409 448 5.97e-1 SMART
WD40 457 494 2.96e1 SMART
low complexity region 500 508 N/A INTRINSIC
WD40 509 548 1.48e-2 SMART
WD40 592 631 4.95e-4 SMART
WD40 634 672 7.92e1 SMART
WD40 675 714 5.75e-1 SMART
WD40 721 760 2.69e-5 SMART
WD40 834 874 8.04e-4 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112363
SMART Domains Protein: ENSMUSP00000107982
Gene: ENSMUSG00000032624

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 240 289 1.79e-1 SMART
Blast:WD40 295 337 3e-19 BLAST
WD40 340 379 5.97e-1 SMART
WD40 388 425 2.96e1 SMART
low complexity region 431 439 N/A INTRINSIC
WD40 440 479 1.48e-2 SMART
WD40 523 562 4.95e-4 SMART
WD40 565 603 7.92e1 SMART
WD40 606 645 5.75e-1 SMART
WD40 652 691 2.69e-5 SMART
WD40 765 805 8.04e-4 SMART
low complexity region 836 848 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the echinoderm microtubule associated protein-like family. The encoded WD-repeat protein may be involved in microtubule formation. Abnormal fusion of parts of this gene with portions of the anaplastic lymphoma receptor tyrosine kinase gene, which generates EML4-ALK fusion transcripts, is one of the primary mutations associated with non-small cell lung cancer. Alternative splicing of this gene results in two transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Eml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Eml4 APN 17 83448184 missense probably benign 0.05
IGL00815:Eml4 APN 17 83450790 splice site probably benign
IGL01969:Eml4 APN 17 83445980 missense possibly damaging 0.95
IGL02005:Eml4 APN 17 83477703 splice site probably benign
IGL02273:Eml4 APN 17 83456379 splice site probably null
IGL02318:Eml4 APN 17 83441366 missense probably benign 0.01
IGL02421:Eml4 APN 17 83477892 missense probably benign 0.00
IGL02728:Eml4 APN 17 83473139 splice site probably null
IGL02814:Eml4 APN 17 83441362 nonsense probably null
IGL02900:Eml4 APN 17 83477992 missense probably benign 0.00
IGL03205:Eml4 APN 17 83454444 missense probably damaging 1.00
erring UTSW 17 83448217 missense probably damaging 1.00
R0147:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0148:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0440:Eml4 UTSW 17 83446058 critical splice donor site probably null
R0541:Eml4 UTSW 17 83440042 missense probably benign 0.00
R0645:Eml4 UTSW 17 83463493 splice site probably benign
R0733:Eml4 UTSW 17 83454464 missense possibly damaging 0.88
R0944:Eml4 UTSW 17 83478060 missense probably benign 0.08
R1071:Eml4 UTSW 17 83478039 nonsense probably null
R1975:Eml4 UTSW 17 83410193 missense probably benign 0.00
R2042:Eml4 UTSW 17 83448178 missense probably damaging 0.97
R2229:Eml4 UTSW 17 83451056 missense probably benign 0.05
R2257:Eml4 UTSW 17 83477760 missense probably damaging 0.99
R2878:Eml4 UTSW 17 83410174 missense probably benign 0.01
R3820:Eml4 UTSW 17 83473065 missense probably damaging 1.00
R4466:Eml4 UTSW 17 83421674 nonsense probably null
R4620:Eml4 UTSW 17 83461533 missense probably benign 0.13
R4657:Eml4 UTSW 17 83450948 nonsense probably null
R4717:Eml4 UTSW 17 83448225 missense probably benign 0.38
R4740:Eml4 UTSW 17 83410030 missense probably damaging 1.00
R5073:Eml4 UTSW 17 83463577 missense probably damaging 1.00
R5699:Eml4 UTSW 17 83410085 missense probably benign 0.16
R5834:Eml4 UTSW 17 83477741 missense probably damaging 1.00
R5944:Eml4 UTSW 17 83446043 missense possibly damaging 0.52
R6044:Eml4 UTSW 17 83445950 missense probably damaging 1.00
R6378:Eml4 UTSW 17 83448217 missense probably damaging 1.00
R6980:Eml4 UTSW 17 83451017 missense probably benign 0.00
R7025:Eml4 UTSW 17 83425311 missense probably benign 0.04
R7042:Eml4 UTSW 17 83461570 missense probably damaging 0.99
R7192:Eml4 UTSW 17 83454461 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTTCACTAGAGGTCACTTCTGTC -3'
(R):5'- TGCCAAATCACAGAATCTAGGTATC -3'

Sequencing Primer
(F):5'- GAGGTCACTTCTGTCCAAAAAG -3'
(R):5'- AGGTATCTTTACAACCATTCCCTAG -3'
Posted On2019-05-13