Incidental Mutation 'R7115:Tas2r131'
ID551723
Institutional Source Beutler Lab
Gene Symbol Tas2r131
Ensembl Gene ENSMUSG00000057699
Gene Nametaste receptor, type 2, member 131
SynonymsmGR31, Tas2r31, mt2r61, T2R31
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location132956884-132957919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132957604 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 81 (F81L)
Ref Sequence ENSEMBL: ENSMUSP00000080736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082085]
Predicted Effect probably benign
Transcript: ENSMUST00000082085
AA Change: F81L

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080736
Gene: ENSMUSG00000057699
AA Change: F81L

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 1.2e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Tas2r131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Tas2r131 APN 6 132957196 missense probably damaging 1.00
IGL00795:Tas2r131 APN 6 132957591 missense possibly damaging 0.94
IGL01023:Tas2r131 APN 6 132957801 missense probably damaging 1.00
IGL02439:Tas2r131 APN 6 132957769 missense probably damaging 1.00
R0335:Tas2r131 UTSW 6 132957829 missense probably benign
R0523:Tas2r131 UTSW 6 132957451 missense possibly damaging 0.71
R1056:Tas2r131 UTSW 6 132957067 missense possibly damaging 0.68
R1069:Tas2r131 UTSW 6 132957825 missense probably benign 0.01
R4073:Tas2r131 UTSW 6 132957839 nonsense probably null
R4719:Tas2r131 UTSW 6 132956973 missense probably damaging 1.00
R5002:Tas2r131 UTSW 6 132957151 missense probably benign 0.00
R5049:Tas2r131 UTSW 6 132957577 missense probably damaging 1.00
R5635:Tas2r131 UTSW 6 132957608 missense probably benign 0.27
R5905:Tas2r131 UTSW 6 132957676 missense probably benign 0.02
R6028:Tas2r131 UTSW 6 132957676 missense probably benign 0.02
R6229:Tas2r131 UTSW 6 132957022 missense probably damaging 1.00
R7561:Tas2r131 UTSW 6 132956958 missense probably benign 0.26
X0025:Tas2r131 UTSW 6 132957538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAATAGGAAGTGTTTCAAGCAG -3'
(R):5'- GCTGGGAAATATGTTCATTGGAC -3'

Sequencing Primer
(F):5'- CTCCACTTAAACCAGAGGAA -3'
(R):5'- TCATTGGACTGGCAAACTGC -3'
Posted On2019-05-15