Incidental Mutation 'R7189:Chrna7'
ID 559493
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms alpha7 nicotinic receptor, alpha7, alpha7-nAChR, Acra7
MMRRC Submission 045238-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7189 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 62748440-62862274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62755775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 257 (D257G)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
AlphaFold P49582
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: D257G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: D257G

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,397,861 (GRCm39) A264S probably benign Het
Atosa T C 9: 74,911,633 (GRCm39) C42R probably damaging Het
Atr G T 9: 95,744,844 (GRCm39) E54* probably null Het
Bmp4 A G 14: 46,621,456 (GRCm39) S363P probably damaging Het
Cfap54 C A 10: 92,773,590 (GRCm39) A2077S unknown Het
Chrnd C T 1: 87,118,780 (GRCm39) R46W probably damaging Het
Cntn2 A G 1: 132,444,824 (GRCm39) I851T probably damaging Het
Col3a1 T A 1: 45,372,817 (GRCm39) I534K unknown Het
Cyp3a25 A T 5: 145,939,870 (GRCm39) L46I probably benign Het
Dnah7b G C 1: 46,281,302 (GRCm39) G2788R probably damaging Het
Dnpep T C 1: 75,290,074 (GRCm39) E301G probably damaging Het
Efcab3 T C 11: 104,986,690 (GRCm39) S30P probably benign Het
Elk4 A G 1: 131,947,127 (GRCm39) I373V probably damaging Het
Fam161b T C 12: 84,395,420 (GRCm39) S508G probably damaging Het
Fgf10 A G 13: 118,925,659 (GRCm39) E146G probably benign Het
Fsip2 A G 2: 82,823,581 (GRCm39) D6438G possibly damaging Het
Garin2 C T 12: 78,758,982 (GRCm39) P101S probably benign Het
Gask1b T A 3: 79,794,114 (GRCm39) L194* probably null Het
Gm49355 T A 14: 12,296,672 (GRCm38) C10* probably null Het
Hfm1 A G 5: 107,049,569 (GRCm39) probably null Het
Hivep3 T C 4: 119,989,416 (GRCm39) S1956P probably damaging Het
Hrh2 A G 13: 54,375,270 (GRCm39) S369G unknown Het
Hspg2 T C 4: 137,260,872 (GRCm39) probably null Het
Hsph1 T C 5: 149,553,925 (GRCm39) Y181C probably damaging Het
Kcnh8 A G 17: 53,201,145 (GRCm39) probably null Het
Kctd1 C T 18: 15,195,700 (GRCm39) E308K possibly damaging Het
Kdm8 A T 7: 125,060,103 (GRCm39) Y335F probably damaging Het
Kif2b C G 11: 91,467,963 (GRCm39) G107R probably benign Het
Lama4 G A 10: 38,841,729 (GRCm39) probably benign Het
Lepr T C 4: 101,671,961 (GRCm39) V995A probably benign Het
Mfsd4a A T 1: 131,980,131 (GRCm39) V375E probably damaging Het
Mgl2 G T 11: 70,027,869 (GRCm39) W359L probably damaging Het
Muc5b C A 7: 141,414,798 (GRCm39) Y2581* probably null Het
Nol10 G T 12: 17,423,562 (GRCm39) probably null Het
Or4k47 T A 2: 111,451,538 (GRCm39) M294L probably benign Het
Or52n3 A T 7: 104,530,348 (GRCm39) K145* probably null Het
Otud3 C T 4: 138,636,865 (GRCm39) V99M probably damaging Het
Parvb T C 15: 84,187,672 (GRCm39) probably null Het
Pclo C A 5: 14,571,932 (GRCm39) P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Pkn1 A T 8: 84,419,302 (GRCm39) H100Q possibly damaging Het
Plce1 A T 19: 38,748,581 (GRCm39) I1771F probably damaging Het
Plxna2 G T 1: 194,483,366 (GRCm39) R1559L possibly damaging Het
Ppp2r3d T A 9: 101,003,621 (GRCm39) I416L possibly damaging Het
Pramel42 T A 5: 94,685,610 (GRCm39) Y423* probably null Het
Robo1 C A 16: 72,757,039 (GRCm39) C333* probably null Het
Ryr2 A T 13: 11,898,009 (GRCm39) Y129N probably damaging Het
Schip1 A T 3: 68,525,032 (GRCm39) K359M probably damaging Het
Schip1 G T 3: 68,525,033 (GRCm39) K359N probably damaging Het
Sh2d2a T A 3: 87,755,668 (GRCm39) S65T possibly damaging Het
Ssrp1 G A 2: 84,875,906 (GRCm39) M588I probably benign Het
Stim2 T A 5: 54,273,470 (GRCm39) C567S probably benign Het
Syne1 C A 10: 5,374,295 (GRCm39) A171S probably benign Het
Tigd3 A G 19: 5,943,050 (GRCm39) S27P probably benign Het
Vipr1 C A 9: 121,493,620 (GRCm39) Q224K probably damaging Het
Vmn1r75 T A 7: 11,614,475 (GRCm39) M69K possibly damaging Het
Vmn2r72 T G 7: 85,404,125 (GRCm39) D22A probably benign Het
Zbtb24 G A 10: 41,340,472 (GRCm39) V523I probably benign Het
Zbtb43 A G 2: 33,352,307 (GRCm39) F20S probably benign Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 62,749,267 (GRCm39) missense probably benign 0.01
IGL01999:Chrna7 APN 7 62,753,539 (GRCm39) missense probably damaging 1.00
IGL02016:Chrna7 APN 7 62,753,583 (GRCm39) missense probably damaging 1.00
IGL02388:Chrna7 APN 7 62,757,439 (GRCm39) missense probably damaging 1.00
IGL02400:Chrna7 APN 7 62,749,070 (GRCm39) missense probably damaging 1.00
IGL02458:Chrna7 APN 7 62,755,842 (GRCm39) missense probably damaging 1.00
IGL03039:Chrna7 APN 7 62,798,340 (GRCm39) missense probably damaging 1.00
inflation UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
thaler UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R0034:Chrna7 UTSW 7 62,798,354 (GRCm39) missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 62,749,391 (GRCm39) missense probably benign 0.00
R1666:Chrna7 UTSW 7 62,861,890 (GRCm39) missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 62,749,255 (GRCm39) missense probably damaging 0.99
R1763:Chrna7 UTSW 7 62,749,000 (GRCm39) missense probably benign 0.05
R1974:Chrna7 UTSW 7 62,749,034 (GRCm39) missense probably damaging 1.00
R2294:Chrna7 UTSW 7 62,760,172 (GRCm39) missense probably benign 0.11
R2393:Chrna7 UTSW 7 62,748,994 (GRCm39) missense probably damaging 1.00
R4598:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4599:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4842:Chrna7 UTSW 7 62,862,196 (GRCm39) missense probably benign 0.05
R5143:Chrna7 UTSW 7 62,755,895 (GRCm39) missense probably damaging 1.00
R5310:Chrna7 UTSW 7 62,755,805 (GRCm39) missense probably damaging 1.00
R5339:Chrna7 UTSW 7 62,749,055 (GRCm39) missense probably damaging 1.00
R5516:Chrna7 UTSW 7 62,749,046 (GRCm39) missense probably damaging 0.98
R5807:Chrna7 UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
R6501:Chrna7 UTSW 7 62,755,863 (GRCm39) missense probably damaging 1.00
R6918:Chrna7 UTSW 7 62,809,299 (GRCm39) missense probably benign 0.03
R7000:Chrna7 UTSW 7 62,755,787 (GRCm39) missense probably damaging 1.00
R7483:Chrna7 UTSW 7 62,754,738 (GRCm39) missense probably damaging 1.00
R7953:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7955:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7956:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R8235:Chrna7 UTSW 7 62,861,972 (GRCm39) missense probably damaging 1.00
R9125:Chrna7 UTSW 7 62,757,357 (GRCm39) nonsense probably null
R9356:Chrna7 UTSW 7 62,757,437 (GRCm39) missense probably damaging 1.00
R9694:Chrna7 UTSW 7 62,754,809 (GRCm39) missense probably damaging 1.00
Z1176:Chrna7 UTSW 7 62,861,932 (GRCm39) missense probably damaging 1.00
Z1177:Chrna7 UTSW 7 62,757,299 (GRCm39) critical splice donor site probably null
Z1191:Chrna7 UTSW 7 62,755,941 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TTCACAAGACCGGGGAATCC -3'
(R):5'- TCCCTGGCAAAAGGAATGAG -3'

Sequencing Primer
(F):5'- TGTCTCCTTAAGAATCAGAACCAGGG -3'
(R):5'- GAATGAGAAGTTCTATGAATGCTGC -3'
Posted On 2019-06-26