Incidental Mutation 'R7313:Slc9a4'
ID567701
Institutional Source Beutler Lab
Gene Symbol Slc9a4
Ensembl Gene ENSMUSG00000026065
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 4
SynonymsD730009J23Rik, NHE4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7313 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location40580081-40630725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40629503 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 769 (T769P)
Ref Sequence ENSEMBL: ENSMUSP00000027233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027233]
Predicted Effect probably benign
Transcript: ENSMUST00000027233
AA Change: T769P

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027233
Gene: ENSMUSG00000026065
AA Change: T769P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 73 477 1.6e-90 PFAM
PDB:2E30|B 481 516 9e-8 PDB
Pfam:NEXCaM_BD 566 675 8.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display normal growth and survival but have gastric secretions with reduced acidity, mild gastric necrosis and apoptosis, and abnormal gastric mucosa with reduced numbers of parietal and chief cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Slc9a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc9a4 APN 1 40629405 missense probably benign 0.01
IGL01802:Slc9a4 APN 1 40607798 missense probably damaging 1.00
IGL01909:Slc9a4 APN 1 40612291 splice site probably benign
IGL02137:Slc9a4 APN 1 40600899 missense possibly damaging 0.79
IGL02399:Slc9a4 APN 1 40600782 missense probably benign 0.00
IGL02685:Slc9a4 APN 1 40629582 missense probably benign
IGL02874:Slc9a4 APN 1 40584038 missense probably benign 0.02
IGL02892:Slc9a4 APN 1 40584044 missense possibly damaging 0.64
IGL03028:Slc9a4 APN 1 40610377 missense probably benign 0.06
IGL03083:Slc9a4 APN 1 40629402 missense probably benign 0.00
IGL03124:Slc9a4 APN 1 40580735 missense probably damaging 0.99
IGL03144:Slc9a4 APN 1 40612202 missense probably damaging 1.00
IGL03286:Slc9a4 APN 1 40580768 missense probably null 0.99
R0601:Slc9a4 UTSW 1 40603070 missense probably damaging 1.00
R1118:Slc9a4 UTSW 1 40584330 splice site probably benign
R1583:Slc9a4 UTSW 1 40600962 missense probably benign 0.01
R1752:Slc9a4 UTSW 1 40629261 missense probably benign 0.00
R1776:Slc9a4 UTSW 1 40629287 missense probably benign 0.00
R1785:Slc9a4 UTSW 1 40607741 splice site probably null
R1786:Slc9a4 UTSW 1 40607741 splice site probably null
R2131:Slc9a4 UTSW 1 40607741 splice site probably null
R2132:Slc9a4 UTSW 1 40607741 splice site probably null
R2133:Slc9a4 UTSW 1 40607741 splice site probably null
R3785:Slc9a4 UTSW 1 40583970 missense probably damaging 1.00
R4223:Slc9a4 UTSW 1 40619126 missense probably damaging 0.98
R4567:Slc9a4 UTSW 1 40580577 missense probably damaging 0.99
R4605:Slc9a4 UTSW 1 40601035 splice site probably null
R4641:Slc9a4 UTSW 1 40607125 missense probably damaging 1.00
R5407:Slc9a4 UTSW 1 40607794 missense probably benign 0.41
R5823:Slc9a4 UTSW 1 40619117 missense probably damaging 0.97
R5877:Slc9a4 UTSW 1 40612263 missense probably benign
R6389:Slc9a4 UTSW 1 40580684 missense probably benign 0.00
R6430:Slc9a4 UTSW 1 40600854 nonsense probably null
R6603:Slc9a4 UTSW 1 40623504 missense probably benign 0.43
R6950:Slc9a4 UTSW 1 40602885 missense probably damaging 1.00
R7102:Slc9a4 UTSW 1 40580639 missense probably benign 0.00
R7102:Slc9a4 UTSW 1 40623399 missense probably damaging 1.00
R7230:Slc9a4 UTSW 1 40600771 missense probably damaging 1.00
R7384:Slc9a4 UTSW 1 40612251 missense probably benign 0.10
R7405:Slc9a4 UTSW 1 40600926 missense probably damaging 1.00
X0060:Slc9a4 UTSW 1 40619031 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGATCCCTATGAAGAGGCTGC -3'
(R):5'- TACCCTGTAGAATGGTGTCTGG -3'

Sequencing Primer
(F):5'- CCCTATGAAGAGGCTGCAGAGAG -3'
(R):5'- GCAAACTTGGTAAATGTTCCAGACTG -3'
Posted On2019-06-26