Incidental Mutation 'R7313:Sspo'
ID567733
Institutional Source Beutler Lab
Gene Symbol Sspo
Ensembl Gene ENSMUSG00000029797
Gene NameSCO-spondin
SynonymsScospondin, C79529
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7313 (G1)
Quality Score214.009
Status Not validated
Chromosome6
Chromosomal Location48448229-48501250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48473456 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 2560 (Q2560K)
Ref Sequence ENSEMBL: ENSMUSP00000131401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]
Predicted Effect probably benign
Transcript: ENSMUST00000043676
AA Change: Q2415K

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: Q2415K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169350
AA Change: Q2560K

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: Q2560K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212740
AA Change: Q2549K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Sspo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Sspo APN 6 48470453 missense probably benign 0.02
IGL00339:Sspo APN 6 48483746 splice site probably benign
IGL00391:Sspo APN 6 48497386 missense probably damaging 0.96
IGL00433:Sspo APN 6 48490036 missense probably damaging 1.00
IGL00471:Sspo APN 6 48498213 splice site probably benign
IGL00500:Sspo APN 6 48497421 nonsense probably null
IGL00537:Sspo APN 6 48498213 splice site probably benign
IGL00540:Sspo APN 6 48498213 splice site probably benign
IGL01060:Sspo APN 6 48449479 nonsense probably null
IGL01090:Sspo APN 6 48490125 missense probably benign 0.08
IGL01125:Sspo APN 6 48492888 missense probably damaging 1.00
IGL01447:Sspo APN 6 48464666 splice site probably null
IGL01457:Sspo APN 6 48498343 missense probably benign 0.00
IGL01481:Sspo APN 6 48448515 missense probably benign 0.41
IGL01485:Sspo APN 6 48478731 missense probably damaging 1.00
IGL01544:Sspo APN 6 48491019 missense probably damaging 0.99
IGL01575:Sspo APN 6 48459042 missense probably benign 0.01
IGL01589:Sspo APN 6 48451178 missense probably damaging 1.00
IGL01601:Sspo APN 6 48486379 missense probably benign 0.33
IGL01644:Sspo APN 6 48452502 missense probably benign
IGL01659:Sspo APN 6 48474443 missense probably damaging 1.00
IGL01801:Sspo APN 6 48457138 missense probably damaging 1.00
IGL01872:Sspo APN 6 48454689 missense probably damaging 0.99
IGL01874:Sspo APN 6 48452190 missense probably damaging 1.00
IGL01936:Sspo APN 6 48475887 missense probably damaging 1.00
IGL01941:Sspo APN 6 48495182 missense probably benign 0.19
IGL01986:Sspo APN 6 48483303 missense probably benign 0.05
IGL01987:Sspo APN 6 48477624 splice site probably null
IGL02170:Sspo APN 6 48467983 missense possibly damaging 0.76
IGL02192:Sspo APN 6 48459568 missense possibly damaging 0.86
IGL02210:Sspo APN 6 48500492 missense probably damaging 1.00
IGL02225:Sspo APN 6 48484334 missense probably benign 0.09
IGL02280:Sspo APN 6 48496231 missense probably damaging 1.00
IGL02303:Sspo APN 6 48484705 missense possibly damaging 0.52
IGL02397:Sspo APN 6 48461638 missense probably benign 0.35
IGL02451:Sspo APN 6 48460303 splice site probably benign
IGL02500:Sspo APN 6 48478379 nonsense probably null
IGL02519:Sspo APN 6 48484828 missense probably damaging 1.00
IGL02549:Sspo APN 6 48451773 missense possibly damaging 0.81
IGL02562:Sspo APN 6 48490122 unclassified probably null
IGL02673:Sspo APN 6 48475860 missense probably damaging 1.00
IGL02673:Sspo APN 6 48498775 critical splice donor site probably null
IGL02719:Sspo APN 6 48482667 missense probably benign 0.39
IGL02793:Sspo APN 6 48487894 splice site probably benign
IGL03003:Sspo APN 6 48455087 missense probably damaging 0.98
IGL03056:Sspo APN 6 48470538 missense probably benign 0.17
IGL03105:Sspo APN 6 48473658 splice site probably benign
IGL03116:Sspo APN 6 48494101 missense probably benign 0.32
IGL03163:Sspo APN 6 48484332 missense probably benign 0.19
IGL03198:Sspo APN 6 48477582 missense probably benign 0.31
IGL03365:Sspo APN 6 48459415 missense possibly damaging 0.82
Barrier UTSW 6 48495212 missense possibly damaging 0.58
ANU74:Sspo UTSW 6 48460959 missense probably damaging 1.00
IGL02984:Sspo UTSW 6 48495155 missense probably benign 0.33
IGL03052:Sspo UTSW 6 48460453 missense probably damaging 1.00
IGL03134:Sspo UTSW 6 48451065 missense probably benign 0.28
PIT4531001:Sspo UTSW 6 48481239 missense probably benign
R0087:Sspo UTSW 6 48477785 missense probably damaging 1.00
R0122:Sspo UTSW 6 48473976 missense possibly damaging 0.95
R0129:Sspo UTSW 6 48455418 missense probably benign 0.00
R0164:Sspo UTSW 6 48494194 splice site probably benign
R0195:Sspo UTSW 6 48486636 missense probably benign
R0200:Sspo UTSW 6 48486415 missense probably null 0.01
R0201:Sspo UTSW 6 48455752 missense possibly damaging 0.64
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0243:Sspo UTSW 6 48493186 missense probably damaging 1.00
R0268:Sspo UTSW 6 48465555 missense probably benign 0.26
R0312:Sspo UTSW 6 48455401 missense possibly damaging 0.52
R0449:Sspo UTSW 6 48466740 missense probably damaging 1.00
R0523:Sspo UTSW 6 48451860 missense probably benign 0.20
R0576:Sspo UTSW 6 48464942 splice site probably null
R0671:Sspo UTSW 6 48490391 splice site probably benign
R0828:Sspo UTSW 6 48498734 missense probably damaging 1.00
R0880:Sspo UTSW 6 48475935 missense possibly damaging 0.69
R0903:Sspo UTSW 6 48455308 critical splice acceptor site probably null
R1051:Sspo UTSW 6 48491455 nonsense probably null
R1083:Sspo UTSW 6 48470999 missense possibly damaging 0.91
R1109:Sspo UTSW 6 48497443 missense probably damaging 1.00
R1118:Sspo UTSW 6 48459418 missense probably damaging 0.97
R1256:Sspo UTSW 6 48457639 missense probably damaging 1.00
R1342:Sspo UTSW 6 48461635 missense probably benign 0.07
R1355:Sspo UTSW 6 48448626 missense probably benign 0.41
R1370:Sspo UTSW 6 48448626 missense probably benign 0.41
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1476:Sspo UTSW 6 48463400 critical splice donor site probably null
R1566:Sspo UTSW 6 48466870 critical splice donor site probably null
R1630:Sspo UTSW 6 48457724 missense probably benign 0.01
R1686:Sspo UTSW 6 48460400 missense probably benign 0.00
R1707:Sspo UTSW 6 48477877 missense probably damaging 0.99
R1727:Sspo UTSW 6 48494848 missense probably damaging 1.00
R1822:Sspo UTSW 6 48492886 missense possibly damaging 0.75
R1831:Sspo UTSW 6 48489786 missense probably damaging 1.00
R1835:Sspo UTSW 6 48457340 missense probably damaging 0.97
R1862:Sspo UTSW 6 48491006 missense probably damaging 0.98
R1878:Sspo UTSW 6 48459366 missense possibly damaging 0.92
R1900:Sspo UTSW 6 48459350 missense probably benign 0.22
R1945:Sspo UTSW 6 48489773 missense possibly damaging 0.93
R1957:Sspo UTSW 6 48478273 missense probably damaging 0.99
R1990:Sspo UTSW 6 48451050 missense probably benign 0.00
R1996:Sspo UTSW 6 48475490 missense possibly damaging 0.50
R2049:Sspo UTSW 6 48460763 splice site probably benign
R2049:Sspo UTSW 6 48463531 missense probably benign 0.36
R2064:Sspo UTSW 6 48473662 missense probably damaging 0.99
R2072:Sspo UTSW 6 48473517 missense probably benign 0.01
R2096:Sspo UTSW 6 48461674 missense probably benign
R2106:Sspo UTSW 6 48466316 missense possibly damaging 0.96
R2230:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2230:Sspo UTSW 6 48500503 missense probably benign 0.11
R2232:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2351:Sspo UTSW 6 48464869 missense probably damaging 1.00
R2423:Sspo UTSW 6 48454055 missense probably benign 0.00
R2508:Sspo UTSW 6 48464364 missense probably damaging 1.00
R3110:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3112:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3413:Sspo UTSW 6 48480697 missense probably damaging 1.00
R3433:Sspo UTSW 6 48475951 splice site probably null
R3498:Sspo UTSW 6 48467980 missense possibly damaging 0.58
R3732:Sspo UTSW 6 48449930 missense probably damaging 1.00
R3816:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3818:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3819:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3838:Sspo UTSW 6 48480820 missense probably damaging 1.00
R3850:Sspo UTSW 6 48492490 missense probably damaging 1.00
R3880:Sspo UTSW 6 48494940 missense probably benign 0.38
R3893:Sspo UTSW 6 48476571 nonsense probably null
R4116:Sspo UTSW 6 48456994 missense probably damaging 0.99
R4179:Sspo UTSW 6 48498395 critical splice donor site probably null
R4180:Sspo UTSW 6 48498395 critical splice donor site probably null
R4207:Sspo UTSW 6 48478293 missense probably benign 0.00
R4210:Sspo UTSW 6 48464901 missense probably benign 0.00
R4223:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4224:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4225:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4229:Sspo UTSW 6 48490934 missense probably benign 0.00
R4230:Sspo UTSW 6 48490934 missense probably benign 0.00
R4363:Sspo UTSW 6 48498731 missense probably damaging 1.00
R4370:Sspo UTSW 6 48466348 missense probably null 0.14
R4407:Sspo UTSW 6 48460520 missense probably damaging 1.00
R4438:Sspo UTSW 6 48487353 missense probably damaging 1.00
R4454:Sspo UTSW 6 48487225 missense probably benign 0.05
R4455:Sspo UTSW 6 48465516 missense probably damaging 1.00
R4561:Sspo UTSW 6 48475534 splice site probably null
R4574:Sspo UTSW 6 48465523 missense probably damaging 1.00
R4578:Sspo UTSW 6 48463373 missense possibly damaging 0.58
R4653:Sspo UTSW 6 48478646 missense probably damaging 1.00
R4656:Sspo UTSW 6 48454076 missense possibly damaging 0.65
R4659:Sspo UTSW 6 48484213 missense probably damaging 1.00
R4664:Sspo UTSW 6 48473534 missense possibly damaging 0.82
R4685:Sspo UTSW 6 48492894 missense probably damaging 0.98
R4692:Sspo UTSW 6 48482687 missense probably damaging 1.00
R4703:Sspo UTSW 6 48500453 missense probably damaging 1.00
R4704:Sspo UTSW 6 48498704 missense probably damaging 1.00
R4738:Sspo UTSW 6 48478396 missense possibly damaging 0.78
R4766:Sspo UTSW 6 48470580 missense probably benign 0.04
R4771:Sspo UTSW 6 48460879 missense probably damaging 1.00
R4790:Sspo UTSW 6 48460771 missense probably benign 0.04
R4792:Sspo UTSW 6 48461585 missense probably benign 0.00
R4808:Sspo UTSW 6 48451161 missense probably damaging 1.00
R4812:Sspo UTSW 6 48490510 missense probably benign 0.00
R4883:Sspo UTSW 6 48460822 missense probably benign 0.00
R4906:Sspo UTSW 6 48465730 critical splice acceptor site probably null
R4934:Sspo UTSW 6 48465552 missense probably damaging 1.00
R4945:Sspo UTSW 6 48467087 splice site probably null
R4967:Sspo UTSW 6 48464605 missense probably damaging 0.97
R5016:Sspo UTSW 6 48452280 nonsense probably null
R5018:Sspo UTSW 6 48455700 missense probably damaging 1.00
R5034:Sspo UTSW 6 48480823 missense possibly damaging 0.93
R5044:Sspo UTSW 6 48466955 critical splice acceptor site probably null
R5055:Sspo UTSW 6 48464795 missense probably damaging 1.00
R5087:Sspo UTSW 6 48488471 missense possibly damaging 0.51
R5155:Sspo UTSW 6 48460474 missense probably benign 0.03
R5223:Sspo UTSW 6 48478324 missense probably damaging 1.00
R5249:Sspo UTSW 6 48493310 missense probably damaging 0.98
R5257:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5258:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5276:Sspo UTSW 6 48490467 missense probably damaging 1.00
R5307:Sspo UTSW 6 48454850 missense probably damaging 0.99
R5341:Sspo UTSW 6 48459615 missense probably damaging 1.00
R5361:Sspo UTSW 6 48466313 missense probably benign 0.02
R5385:Sspo UTSW 6 48462253 missense probably benign 0.18
R5394:Sspo UTSW 6 48495260 missense possibly damaging 0.52
R5477:Sspo UTSW 6 48498393 missense possibly damaging 0.60
R5490:Sspo UTSW 6 48493280 missense probably benign 0.33
R5512:Sspo UTSW 6 48455671 missense probably damaging 0.97
R5518:Sspo UTSW 6 48496654 missense possibly damaging 0.92
R5530:Sspo UTSW 6 48465583 missense probably damaging 0.97
R5538:Sspo UTSW 6 48452178 missense probably damaging 0.99
R5590:Sspo UTSW 6 48474491 missense probably damaging 1.00
R5613:Sspo UTSW 6 48455044 missense possibly damaging 0.79
R5638:Sspo UTSW 6 48492891 missense possibly damaging 0.86
R5809:Sspo UTSW 6 48460045 missense possibly damaging 0.59
R5810:Sspo UTSW 6 48483898 missense probably benign 0.02
R5814:Sspo UTSW 6 48451884 missense probably damaging 1.00
R5915:Sspo UTSW 6 48464596 missense probably benign 0.00
R5915:Sspo UTSW 6 48491484 missense possibly damaging 0.83
R5979:Sspo UTSW 6 48463693 missense probably benign 0.20
R5996:Sspo UTSW 6 48494176 missense possibly damaging 0.87
R6012:Sspo UTSW 6 48451371 missense probably benign 0.00
R6025:Sspo UTSW 6 48486786 missense possibly damaging 0.83
R6120:Sspo UTSW 6 48465576 missense probably damaging 1.00
R6150:Sspo UTSW 6 48486379 missense probably benign 0.33
R6221:Sspo UTSW 6 48463705 missense probably damaging 1.00
R6261:Sspo UTSW 6 48462191 missense possibly damaging 0.75
R6312:Sspo UTSW 6 48457366 critical splice donor site probably null
R6372:Sspo UTSW 6 48472541 missense probably damaging 1.00
R6456:Sspo UTSW 6 48451806 missense probably benign 0.08
R6497:Sspo UTSW 6 48495208 missense possibly damaging 0.71
R6501:Sspo UTSW 6 48495212 missense possibly damaging 0.58
R6617:Sspo UTSW 6 48491046 missense possibly damaging 0.93
R6825:Sspo UTSW 6 48465525 missense probably benign 0.04
R6831:Sspo UTSW 6 48484833 missense possibly damaging 0.68
R6861:Sspo UTSW 6 48487955 missense probably benign 0.15
R6961:Sspo UTSW 6 48463877 missense probably benign 0.05
R6967:Sspo UTSW 6 48489794 missense probably benign 0.21
R7016:Sspo UTSW 6 48449164 missense probably damaging 1.00
R7035:Sspo UTSW 6 48449213 intron probably null
R7058:Sspo UTSW 6 48448582 missense probably damaging 1.00
R7072:Sspo UTSW 6 48454979 missense probably damaging 1.00
R7078:Sspo UTSW 6 48460379 missense probably damaging 1.00
R7082:Sspo UTSW 6 48478609 critical splice acceptor site probably null
R7120:Sspo UTSW 6 48465571 missense probably benign 0.05
R7127:Sspo UTSW 6 48449512 missense probably benign 0.02
R7146:Sspo UTSW 6 48501095 missense probably benign 0.15
R7220:Sspo UTSW 6 48476606 nonsense probably null
R7242:Sspo UTSW 6 48473952 missense probably benign
R7261:Sspo UTSW 6 48450077 missense possibly damaging 0.52
R7313:Sspo UTSW 6 48454828 missense probably damaging 1.00
R7323:Sspo UTSW 6 48461647 missense possibly damaging 0.93
X0060:Sspo UTSW 6 48466294 missense probably damaging 1.00
X0060:Sspo UTSW 6 48480794 missense probably damaging 1.00
X0063:Sspo UTSW 6 48497422 missense probably damaging 0.96
X0065:Sspo UTSW 6 48461684 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGTTTCCCACAATACAAGG -3'
(R):5'- GATCCTGAGACAAACCTTGGG -3'

Sequencing Primer
(F):5'- TAGAACTGCTAGGGTGCTGCC -3'
(R):5'- AACCTTGGGACTCTACTGTCAGAG -3'
Posted On2019-06-26