Incidental Mutation 'R7313:Casr'
ID567792
Institutional Source Beutler Lab
Gene Symbol Casr
Ensembl Gene ENSMUSG00000051980
Gene Namecalcium-sensing receptor
SynonymsCaR, cation sensing receptor, Gprc2a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7313 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location36493696-36562141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36509671 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 434 (I434V)
Ref Sequence ENSEMBL: ENSMUSP00000069080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]
Predicted Effect probably damaging
Transcript: ENSMUST00000063597
AA Change: I434V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: I434V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 1e-13 PFAM
Pfam:ANF_receptor 69 495 1.1e-114 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 624 859 7.4e-61 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114847
AA Change: I434V

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: I434V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.1e-14 PFAM
Pfam:ANF_receptor 69 461 2.8e-99 PFAM
Pfam:NCD3G 461 514 1.2e-20 PFAM
Pfam:7tm_3 545 783 9.9e-87 PFAM
low complexity region 817 843 N/A INTRINSIC
low complexity region 853 884 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172826
AA Change: I434V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: I434V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.4e-14 PFAM
Pfam:ANF_receptor 69 495 3.9e-111 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 622 860 1.1e-86 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mki67 G C 7: 135,694,671 A2878G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Casr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Casr APN 16 36495810 missense probably damaging 1.00
IGL01587:Casr APN 16 36509765 missense probably benign
IGL02323:Casr APN 16 36509710 missense probably damaging 1.00
IGL02369:Casr APN 16 36494689 missense probably benign 0.03
IGL02514:Casr APN 16 36500325 missense probably damaging 1.00
IGL02547:Casr APN 16 36515674 missense probably benign 0.06
IGL02633:Casr APN 16 36515655 missense probably damaging 1.00
IGL03061:Casr APN 16 36495888 missense probably benign 0.07
R1163:Casr UTSW 16 36494807 missense probably damaging 1.00
R1539:Casr UTSW 16 36495137 missense probably benign 0.10
R1643:Casr UTSW 16 36500205 missense probably damaging 1.00
R1664:Casr UTSW 16 36509965 nonsense probably null
R1694:Casr UTSW 16 36495591 missense probably damaging 1.00
R2040:Casr UTSW 16 36510366 missense possibly damaging 0.79
R2092:Casr UTSW 16 36510043 missense possibly damaging 0.96
R2125:Casr UTSW 16 36495252 missense possibly damaging 0.90
R2190:Casr UTSW 16 36495416 missense probably damaging 1.00
R2214:Casr UTSW 16 36515758 missense probably damaging 1.00
R4409:Casr UTSW 16 36500341 missense probably benign 0.01
R4410:Casr UTSW 16 36500341 missense probably benign 0.01
R4591:Casr UTSW 16 36500370 missense probably benign 0.05
R5451:Casr UTSW 16 36509908 missense probably damaging 0.99
R5469:Casr UTSW 16 36510030 missense probably benign 0.29
R5581:Casr UTSW 16 36494744 missense probably benign 0.01
R5700:Casr UTSW 16 36509617 missense probably damaging 0.99
R6258:Casr UTSW 16 36517609 missense probably damaging 1.00
R6447:Casr UTSW 16 36495545 missense probably damaging 1.00
R6751:Casr UTSW 16 36515588 missense probably benign 0.00
R6938:Casr UTSW 16 36495921 missense probably damaging 1.00
R7063:Casr UTSW 16 36494574 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCACCGAGCCACAAAAG -3'
(R):5'- GGAAGAAACATTTAATTGCCACCT -3'

Sequencing Primer
(F):5'- AGCAAATAATGTTTCTTTTCTGCGCC -3'
(R):5'- GCAAAAGGACCTTTACCCGTGG -3'
Posted On2019-06-26