Mutagenetix > Incidental Mutation

Incidental Mutation 'R7532:Cdh20'

583341

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

045604-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R7532 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110065889 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 721 (D721V)

Ref Sequence

ENSEMBL: ENSMUSP00000129715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]

AlphaFold

Q9Z0M3

Predicted Effect

probably damaging
Transcript: ENSMUST00000027542
AA Change: D721V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: D721V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	633	778	6e-54	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112701
AA Change: D721V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: D721V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131464

SMART Domains

Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
PDB:1ZVN\|B	49	70	1e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000134301

SMART Domains

Protein: ENSMUSP00000123394
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
CA	24	111	2.26e-9	SMART
transmembrane domain	125	147	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172005
AA Change: D721V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: D721V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Meta Mutation Damage Score

0.9124

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add3	T	A	19: 53,220,589 (GRCm39)	I174K	probably damaging	Het
Ano2	A	T	6: 125,940,667 (GRCm39)	I597F	probably damaging	Het
Ap1g1	T	C	8: 110,586,796 (GRCm39)	V813A	probably damaging	Het
Bpnt1	A	T	1: 185,084,523 (GRCm39)	I207F	possibly damaging	Het
Brinp3	T	A	1: 146,777,139 (GRCm39)	W529R	probably damaging	Het
C2cd2l	C	T	9: 44,226,681 (GRCm39)	R355Q	probably benign	Het
Ccser1	T	A	6: 62,356,915 (GRCm39)	C784*	probably null	Het
Chd9	A	G	8: 91,721,193 (GRCm39)	I994V	unknown	Het
Cst13	T	G	2: 148,665,127 (GRCm39)	Y41D	probably benign	Het
Cyth2	C	T	7: 45,457,448 (GRCm39)	A342T	probably benign	Het
Dapk1	T	C	13: 60,878,700 (GRCm39)	L563P	probably damaging	Het
Dclk3	T	G	9: 111,296,596 (GRCm39)	S47A	probably benign	Het
Dync1h1	C	A	12: 110,618,011 (GRCm39)	N3183K	probably benign	Het
Enpp1	C	T	10: 24,551,885 (GRCm39)	V165M	probably benign	Het
Ephx3	T	C	17: 32,407,763 (GRCm39)	N173S	possibly damaging	Het
Erc1	T	A	6: 119,756,592 (GRCm39)	D388V	probably benign	Het
Esp34	T	G	17: 38,870,511 (GRCm39)	V135G	possibly damaging	Het
Gfy	G	A	7: 44,827,461 (GRCm39)	P212S	probably damaging	Het
Gm5239	C	T	18: 35,669,795 (GRCm39)	R54C	probably benign	Het
Gtpbp3	T	C	8: 71,942,107 (GRCm39)	F113L	probably benign	Het
Hectd1	T	A	12: 51,837,233 (GRCm39)	D775V	probably damaging	Het
Ifrd2	T	G	9: 107,469,721 (GRCm39)	S431R	probably damaging	Het
Impg2	G	A	16: 56,087,543 (GRCm39)	A1121T	probably damaging	Het
Irx1	A	G	13: 72,108,314 (GRCm39)	F123L	possibly damaging	Het
Itgb6	C	T	2: 60,499,557 (GRCm39)	V79I	probably benign	Het
Kcnd3	G	A	3: 105,575,526 (GRCm39)	R550H	probably damaging	Het
Klhl9	A	T	4: 88,639,090 (GRCm39)	S384T	possibly damaging	Het
Kng2	T	C	16: 22,845,794 (GRCm39)		probably null	Het
Lipo3	T	C	19: 33,560,464 (GRCm39)	N67S	possibly damaging	Het
Mgst1	T	C	6: 138,130,504 (GRCm39)	S78P	probably benign	Het
Ms4a14	A	G	19: 11,281,323 (GRCm39)	Y412H	possibly damaging	Het
Mucl2	A	C	15: 103,926,318 (GRCm39)	I124S	unknown	Het
Myh3	A	G	11: 66,981,921 (GRCm39)	M806V	probably benign	Het
Nelfcd	T	C	2: 174,268,189 (GRCm39)	L501P	probably damaging	Het
Nlrp6	C	A	7: 140,505,097 (GRCm39)	P748Q	probably benign	Het
Or1j13	C	T	2: 36,370,138 (GRCm39)	M1I	probably null	Het
Or6n2	T	C	1: 173,897,664 (GRCm39)	S267P	probably benign	Het
Plxna2	G	A	1: 194,327,127 (GRCm39)	A354T	probably benign	Het
Prpf39	G	T	12: 65,100,145 (GRCm39)	V273L	probably benign	Het
Rad9a	T	C	19: 4,251,522 (GRCm39)		probably benign	Het
Rnf135	A	G	11: 80,089,732 (GRCm39)	D356G	probably benign	Het
Rragd	G	T	4: 33,004,166 (GRCm39)	A153S	possibly damaging	Het
Selenot	G	T	3: 58,492,653 (GRCm39)	V47L	probably benign	Het
Smc2	T	C	4: 52,451,013 (GRCm39)	L277P	probably damaging	Het
Sp7	A	G	15: 102,267,584 (GRCm39)	F92S	possibly damaging	Het
Spata1	A	T	3: 146,173,946 (GRCm39)	I380N	possibly damaging	Het
Spdye4b	G	T	5: 143,180,652 (GRCm39)	R39S	possibly damaging	Het
Spmip9	T	C	6: 70,890,621 (GRCm39)	K57R	probably benign	Het
Stom	C	A	2: 35,211,589 (GRCm39)	R144L	possibly damaging	Het
Tsc22d1	T	C	14: 76,653,486 (GRCm39)		probably benign	Het
Unc13b	A	G	4: 43,249,565 (GRCm39)	T998A	probably benign	Het
Vcl	C	A	14: 21,079,392 (GRCm39)	A965D	probably damaging	Het
Vmn1r69	A	T	7: 10,314,281 (GRCm39)	V150D	probably damaging	Het
Vmn1r90	T	G	7: 14,295,189 (GRCm39)	N303T	possibly damaging	Het
Vmn2r69	A	T	7: 85,059,622 (GRCm39)	M429K	probably benign	Het
Vmn2r8	T	A	5: 108,950,106 (GRCm39)	Y247F	probably benign	Het
Washc5	A	T	15: 59,239,260 (GRCm39)	S168T	possibly damaging	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2068:Cdh20	UTSW	1	110,065,666 (GRCm39)	nonsense	probably null
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2198:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5196:Cdh20	UTSW	1	110,065,730 (GRCm39)	missense	probably damaging	0.99
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5496:Cdh20	UTSW	1	109,976,647 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104,869,004 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8022:Cdh20	UTSW	1	109,988,838 (GRCm39)	missense	probably benign	0.02
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104,898,583 (GRCm39)	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGACACAGAAGCCTTTGAC -3'
(R):5'- TTCCAAAGTAAGGGTCCAAGG -3'

Sequencing Primer
(F):5'- ACAGAAGCCTTTGACATGGC -3'
(R):5'- TTCCAAAGTAAGGGTCCAAGGCTATG -3'

Posted On

2019-10-17