Incidental Mutation 'R0020:Gon4l'
ID64731
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission 038315-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R0020 (G1)
Quality Score82
Status Validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88858937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 428 (V428L)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect probably damaging
Transcript: ENSMUST00000081695
AA Change: V428L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: V428L

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082804
Predicted Effect probably damaging
Transcript: ENSMUST00000090942
AA Change: V429L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: V429L

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107498
AA Change: V428L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: V428L

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Predicted Effect possibly damaging
Transcript: ENSMUST00000212694
AA Change: V136L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,197 D2032E probably damaging Het
Ado T C 10: 67,548,097 D226G probably benign Het
Agfg2 C T 5: 137,653,802 V432M probably benign Het
Atf2 T C 2: 73,846,284 D122G possibly damaging Het
AW549877 T C 15: 3,991,868 probably benign Het
C330027C09Rik A T 16: 49,001,612 H201L probably damaging Het
Cd2bp2 G A 7: 127,193,824 T342M probably damaging Het
Col6a3 T A 1: 90,811,550 I319F probably damaging Het
Cst11 T A 2: 148,771,333 Y24F probably damaging Het
Cstb T A 10: 78,427,336 V65E probably benign Het
Cyp2j11 G A 4: 96,307,404 H352Y probably benign Het
D130043K22Rik T A 13: 24,854,492 probably benign Het
Dbh A G 2: 27,170,572 probably benign Het
Dhdh T C 7: 45,488,104 K53R probably benign Het
Drc3 A G 11: 60,370,545 Y174C probably damaging Het
Ezr G T 17: 6,742,727 Q308K probably damaging Het
F3 A T 3: 121,731,616 N169Y probably damaging Het
Fbn2 G T 18: 58,105,164 T587K probably damaging Het
Fhl5 A T 4: 25,200,054 V260E probably benign Het
Glyr1 A G 16: 5,037,049 I55T probably damaging Het
Gm12695 G C 4: 96,769,735 P66A probably damaging Het
Gm6614 A T 6: 141,972,350 V600E possibly damaging Het
Grasp T C 15: 101,230,552 V157A probably damaging Het
Ighv6-5 T C 12: 114,416,621 D92G probably null Het
Inhba A C 13: 16,026,364 K170N possibly damaging Het
Kng2 A G 16: 22,997,296 V317A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Map3k14 T C 11: 103,227,674 E562G probably damaging Het
Megf10 G T 18: 57,287,893 V868F possibly damaging Het
Nap1l1 A C 10: 111,491,023 E148D probably benign Het
Nlrp4a A T 7: 26,450,372 H468L probably damaging Het
Nphs1 G T 7: 30,463,208 V357L probably benign Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Pclo A G 5: 14,669,673 T1275A unknown Het
Pde4d T A 13: 109,954,570 C35S possibly damaging Het
Pkd1l1 A G 11: 8,875,765 probably benign Het
Pkd2 A G 5: 104,503,516 E910G probably damaging Het
Pot1b T A 17: 55,653,429 M634L probably benign Het
Ppp2r5c C T 12: 110,574,823 Q469* probably null Het
Ppp6r2 T A 15: 89,259,139 M163K probably damaging Het
Prss43 C A 9: 110,828,512 probably benign Het
Rb1cc1 C A 1: 6,264,548 N1444K possibly damaging Het
Scube2 A G 7: 109,830,888 probably benign Het
Slamf9 T C 1: 172,475,515 S7P possibly damaging Het
Slc35b2 T A 17: 45,566,856 M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 F1116I probably benign Het
Smarcad1 T A 6: 65,084,007 probably benign Het
Tns3 A C 11: 8,545,227 probably null Het
Zfp282 T G 6: 47,880,009 W59G probably damaging Het
Zfp746 C A 6: 48,064,707 A362S probably benign Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACACACTAGATGAGCACTGGCTGC -3'
(R):5'- AGAAACTGTCATCCCTGTCAGCCC -3'

Sequencing Primer
(F):5'- AAAGCCAAGTAGTGTTCTGTTTGC -3'
(R):5'- ACAGCCTTATCTGAGCAGAAAG -3'
Posted On2013-08-06