Incidental Mutation 'R4901:Gon4l'
ID376140
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88908151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2008 (V2008A)
Ref Sequence ENSEMBL: ENSMUSP00000088461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107494] [ENSMUST00000107498] [ENSMUST00000126245]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
AA Change: V2007A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: V2007A

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083302
Predicted Effect possibly damaging
Transcript: ENSMUST00000090942
AA Change: V2008A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: V2008A

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107494
SMART Domains Protein: ENSMUSP00000103118
Gene: ENSMUSG00000068922

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
Pfam:Tubulin_3 153 345 5.3e-28 PFAM
Pfam:Tubulin 169 300 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107498
AA Change: V2007A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: V2007A

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126245
SMART Domains Protein: ENSMUSP00000115645
Gene: ENSMUSG00000068922

DomainStartEndE-ValueType
Pfam:Misat_Tub_SegII 6 120 2.1e-36 PFAM
Pfam:Tubulin_3 140 332 1.9e-27 PFAM
Pfam:Tubulin 151 288 8.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147828
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I possibly damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATTGTTGTAGCTCCCCAGG -3'
(R):5'- CTCTGGTCCTTGTAGAAACAGGAC -3'

Sequencing Primer
(F):5'- GATCCCATATTCCTTCTAAGCAGGG -3'
(R):5'- TCCTTGTAGAAACAGGACTTGGG -3'
Posted On2016-03-17