Incidental Mutation 'R0846:Cobll1'
ID77353
Institutional Source Beutler Lab
Gene Symbol Cobll1
Ensembl Gene ENSMUSG00000034903
Gene NameCobl-like 1
SynonymsD430044D16Rik, Coblr1
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location65088339-65239403 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 65102065 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431]
Predicted Effect probably null
Transcript: ENSMUST00000090896
SMART Domains Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 1.3e-38 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 1023 1034 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102726
SMART Domains Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1060 1071 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112429
SMART Domains Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
Pfam:Cobl 148 239 5.4e-49 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112430
SMART Domains Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
Pfam:Cobl 185 263 1.3e-38 PFAM
low complexity region 331 342 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112431
SMART Domains Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155768
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Cobll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cobll1 APN 2 65126013 missense probably damaging 1.00
IGL01074:Cobll1 APN 2 65107848 missense probably damaging 1.00
IGL01093:Cobll1 APN 2 65098237 missense probably damaging 1.00
IGL02411:Cobll1 APN 2 65097740 missense probably damaging 1.00
IGL02419:Cobll1 APN 2 65151048 missense probably damaging 1.00
IGL02550:Cobll1 APN 2 65107863 missense probably damaging 1.00
IGL02607:Cobll1 APN 2 65151085 missense probably damaging 0.98
IGL02829:Cobll1 APN 2 65126045 missense probably damaging 1.00
IGL02802:Cobll1 UTSW 2 65098319 missense probably damaging 0.99
R0313:Cobll1 UTSW 2 65095744 nonsense probably null
R0314:Cobll1 UTSW 2 65089521 missense possibly damaging 0.81
R0322:Cobll1 UTSW 2 65102098 missense possibly damaging 0.84
R1163:Cobll1 UTSW 2 65098279 missense probably damaging 0.96
R1242:Cobll1 UTSW 2 65151169 critical splice acceptor site probably null
R1364:Cobll1 UTSW 2 65126310 splice site probably benign
R1445:Cobll1 UTSW 2 65099136 missense probably damaging 1.00
R1610:Cobll1 UTSW 2 65133642 missense probably damaging 1.00
R1836:Cobll1 UTSW 2 65126236 missense probably damaging 1.00
R2102:Cobll1 UTSW 2 65098210 missense probably damaging 1.00
R3154:Cobll1 UTSW 2 65107050 missense probably benign 0.00
R4580:Cobll1 UTSW 2 65151073 missense probably benign 0.00
R4638:Cobll1 UTSW 2 65099237 missense probably benign 0.03
R4684:Cobll1 UTSW 2 65099028 missense possibly damaging 0.90
R4906:Cobll1 UTSW 2 65097693 missense probably benign 0.01
R4923:Cobll1 UTSW 2 65099258 missense possibly damaging 0.87
R5100:Cobll1 UTSW 2 65125901 missense probably benign 0.26
R5269:Cobll1 UTSW 2 65133771 nonsense probably null
R5419:Cobll1 UTSW 2 65103357 missense possibly damaging 0.57
R5637:Cobll1 UTSW 2 65125903 missense possibly damaging 0.90
R5745:Cobll1 UTSW 2 65098457 missense probably damaging 0.99
R5777:Cobll1 UTSW 2 65103268 missense probably benign 0.27
R6303:Cobll1 UTSW 2 65098033 missense possibly damaging 0.68
R6471:Cobll1 UTSW 2 65107884 missense probably damaging 1.00
X0020:Cobll1 UTSW 2 65103322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAAGTTTCATCCAGAGTGTGGC -3'
(R):5'- TGCAGTAGGACCAGTGTACCCAAG -3'

Sequencing Primer
(F):5'- agacagtatcttcgtggtttactc -3'
(R):5'- CAGTGTACCCAAGCTAATGTTTGC -3'
Posted On2013-10-16