Incidental Mutation 'R0947:Prom2'
ID81651
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Nameprominin 2
Synonyms
MMRRC Submission 039086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0947 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127526473-127541467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127538263 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 350 (Q350K)
Ref Sequence ENSEMBL: ENSMUSP00000099503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028855
AA Change: Q350K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376
AA Change: Q350K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103214
AA Change: Q350K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376
AA Change: Q350K

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155581
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A T 18: 56,560,838 probably null Het
Atm A G 9: 53,504,092 V833A probably benign Het
Atp6v1b1 A T 6: 83,753,832 I180F probably damaging Het
Cwf19l2 T C 9: 3,421,286 S188P probably benign Het
Gdpd1 T G 11: 87,037,881 E240D probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htt T C 5: 34,898,924 S2681P probably damaging Het
Itgad A G 7: 128,175,693 D40G probably benign Het
Krt18 A G 15: 102,030,728 Y249C possibly damaging Het
Lrp2 G T 2: 69,487,838 P2090T probably damaging Het
Lrrc32 A G 7: 98,498,883 D290G probably benign Het
Man1a A T 10: 53,933,523 Y486* probably null Het
Mcm9 CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC 10: 53,537,501 probably benign Het
Nin A T 12: 70,061,186 C211S probably damaging Het
Npat A C 9: 53,570,324 I1111L probably benign Het
Olfr1505 T A 19: 13,919,171 H50Q probably benign Het
Olfr507 A G 7: 108,622,672 I287V probably benign Het
Pbx1 A G 1: 168,203,366 S228P probably damaging Het
Pcsk7 G T 9: 45,911,172 R230L probably damaging Het
Racgap1 C T 15: 99,624,314 A458T possibly damaging Het
Rsf1 T A 7: 97,669,778 C912S probably damaging Het
Setd2 G A 9: 110,548,511 E465K possibly damaging Het
Sgk2 T A 2: 163,006,838 D269E probably benign Het
Spsb1 T C 4: 149,907,079 T11A probably benign Het
Tln2 A T 9: 67,295,813 S509T probably benign Het
Trim5 A T 7: 104,265,751 D370E probably damaging Het
Ttn T A 2: 76,885,230 probably benign Het
Ubr2 C A 17: 46,941,112 G1501C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r93 A T 17: 18,304,081 R112S probably benign Het
Vps26b T C 9: 27,012,781 Y222C probably damaging Het
Wdr64 T A 1: 175,775,749 Y198N probably benign Het
Xrn1 A T 9: 95,998,263 K752I possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp386 T C 12: 116,059,778 I372T probably benign Het
Zfp804a T C 2: 82,258,718 Y964H possibly damaging Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127541139 missense probably benign 0.04
IGL01140:Prom2 APN 2 127531205 splice site probably benign
IGL01300:Prom2 APN 2 127535089 missense probably benign 0.44
IGL01445:Prom2 APN 2 127539513 splice site probably benign
IGL01472:Prom2 APN 2 127532882 missense probably benign 0.39
IGL01541:Prom2 APN 2 127529130 critical splice donor site probably null
IGL01991:Prom2 APN 2 127529222 missense probably damaging 1.00
IGL02421:Prom2 APN 2 127531882 critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127529471 missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127538657 splice site probably benign
IGL02826:Prom2 APN 2 127531116 missense probably benign 0.07
IGL02830:Prom2 APN 2 127535069 missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127528814 missense probably benign 0.10
R0110:Prom2 UTSW 2 127531113 missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127538338 splice site probably benign
R0165:Prom2 UTSW 2 127539514 splice site probably benign
R0220:Prom2 UTSW 2 127541107 missense probably benign 0.03
R0466:Prom2 UTSW 2 127528789 missense probably damaging 0.99
R0505:Prom2 UTSW 2 127532867 missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127539995 critical splice donor site probably null
R0633:Prom2 UTSW 2 127539525 missense probably benign 0.19
R1682:Prom2 UTSW 2 127540162 missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127532882 missense probably damaging 1.00
R1859:Prom2 UTSW 2 127541097 missense probably damaging 0.97
R1864:Prom2 UTSW 2 127539787 missense probably benign 0.00
R1866:Prom2 UTSW 2 127536594 missense probably damaging 0.99
R3824:Prom2 UTSW 2 127535673 splice site probably benign
R4472:Prom2 UTSW 2 127540191 missense probably benign 0.06
R5078:Prom2 UTSW 2 127531837 missense probably benign 0.00
R5889:Prom2 UTSW 2 127529411 missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127530133 nonsense probably null
R6214:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6215:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6914:Prom2 UTSW 2 127530375 missense possibly damaging 0.78
R7099:Prom2 UTSW 2 127539778 missense probably benign
R7427:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7428:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7525:Prom2 UTSW 2 127532781 missense not run
Predicted Primers PCR Primer
(F):5'- TGCAGATCAACCTCTCCCATCTGAC -3'
(R):5'- GAGTGAGCTGAAGCTCTCAGTGTG -3'

Sequencing Primer
(F):5'- ggctgtcctggaactcac -3'
(R):5'- tgccacacactgagccc -3'
Posted On2013-11-08