Incidental Mutation 'R1282:Scd2'
ID151079
Institutional Source Beutler Lab
Gene Symbol Scd2
Ensembl Gene ENSMUSG00000025203
Gene Namestearoyl-Coenzyme A desaturase 2
SynonymsScd-2
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1282 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44293676-44306864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44295181 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 101 (L101P)
Ref Sequence ENSEMBL: ENSMUSP00000026221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026221]
Predicted Effect probably damaging
Transcript: ENSMUST00000026221
AA Change: L101P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026221
Gene: ENSMUSG00000025203
AA Change: L101P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
Pfam:FA_desaturase 96 315 4.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality with variable penetrance depending on stain background, impaired skin barrier function, abnormal epidermal morphology, and abnormal lipid homeostasis in the skin and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Scd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Scd2 APN 19 44298130 missense probably damaging 1.00
IGL01105:Scd2 APN 19 44298058 missense probably benign 0.38
IGL02201:Scd2 APN 19 44301340 missense probably damaging 0.99
IGL02680:Scd2 APN 19 44301246 missense probably benign 0.00
unkinked UTSW 19 44299759 nonsense probably null
R0012:Scd2 UTSW 19 44301246 missense probably benign 0.00
R0366:Scd2 UTSW 19 44301246 missense probably benign 0.00
R0368:Scd2 UTSW 19 44301246 missense probably benign 0.00
R0373:Scd2 UTSW 19 44303040 missense probably damaging 1.00
R1581:Scd2 UTSW 19 44298099 missense probably benign 0.04
R2008:Scd2 UTSW 19 44303171 missense probably benign 0.23
R2329:Scd2 UTSW 19 44298053 nonsense probably null
R4755:Scd2 UTSW 19 44301352 missense probably damaging 1.00
R4812:Scd2 UTSW 19 44301402 missense probably damaging 1.00
R5024:Scd2 UTSW 19 44301271 missense probably benign 0.02
R5568:Scd2 UTSW 19 44299703 missense probably damaging 0.99
R5702:Scd2 UTSW 19 44298063 missense possibly damaging 0.75
R6248:Scd2 UTSW 19 44303009 missense probably damaging 1.00
R6377:Scd2 UTSW 19 44299759 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATTGCAGATCTCTGGCGCTTAC -3'
(R):5'- CCCCATTCTTAACACCACGAGGTTC -3'

Sequencing Primer
(F):5'- CACTGGGGAGCAGATGTTCG -3'
(R):5'- AACACCACGAGGTTCTTTGC -3'
Posted On2014-01-29