Incidental Mutation 'R1282:Exoc3'
ID 151071
Institutional Source Beutler Lab
Gene Symbol Exoc3
Ensembl Gene ENSMUSG00000034152
Gene Name exocyst complex component 3
Synonyms Sec6l1, E430013E20Rik, 2810050O03Rik
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R1282 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 74169488-74208732 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74182292 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 506 (N506S)
Ref Sequence ENSEMBL: ENSMUSP00000039416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035934]
AlphaFold Q6KAR6
Predicted Effect probably benign
Transcript: ENSMUST00000035934
AA Change: N506S

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152
AA Change: N506S

DomainStartEndE-ValueType
Pfam:Sec6 187 743 1.7e-162 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Exoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Exoc3 APN 13 74206906 critical splice donor site probably null
IGL01444:Exoc3 APN 13 74206935 missense probably damaging 1.00
IGL02095:Exoc3 APN 13 74180536 missense probably damaging 1.00
IGL02370:Exoc3 APN 13 74192761 missense probably benign 0.02
IGL02704:Exoc3 APN 13 74174144 missense probably benign 0.00
IGL03113:Exoc3 APN 13 74193113 nonsense probably null
R0037:Exoc3 UTSW 13 74199539 missense probably damaging 0.99
R0565:Exoc3 UTSW 13 74182275 critical splice donor site probably null
R1438:Exoc3 UTSW 13 74190179 missense probably damaging 1.00
R1694:Exoc3 UTSW 13 74190065 splice site probably null
R1913:Exoc3 UTSW 13 74182316 missense probably damaging 1.00
R1915:Exoc3 UTSW 13 74173294 critical splice donor site probably null
R2039:Exoc3 UTSW 13 74192977 missense probably benign
R4272:Exoc3 UTSW 13 74192644 missense probably damaging 1.00
R4852:Exoc3 UTSW 13 74199645 missense probably damaging 1.00
R5698:Exoc3 UTSW 13 74174015 missense probably benign 0.13
R5909:Exoc3 UTSW 13 74199524 missense probably damaging 0.98
R5969:Exoc3 UTSW 13 74172186 nonsense probably null
R6248:Exoc3 UTSW 13 74182281 missense probably benign 0.40
R6433:Exoc3 UTSW 13 74189187 missense possibly damaging 0.93
R6599:Exoc3 UTSW 13 74189158 splice site probably null
R6861:Exoc3 UTSW 13 74189200 missense probably benign
R7000:Exoc3 UTSW 13 74182166 missense probably benign 0.41
R7384:Exoc3 UTSW 13 74172156 missense probably benign 0.00
R8098:Exoc3 UTSW 13 74172152 missense probably benign
R8146:Exoc3 UTSW 13 74192665 missense probably benign 0.00
R9548:Exoc3 UTSW 13 74182166 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGCAGACAAGCCTTTGACTGTAGC -3'
(R):5'- GACTCCTCTGGTCCAAAAGTGGTG -3'

Sequencing Primer
(F):5'- CCTTAGCAATGGCGTCTAGAATC -3'
(R):5'- GGTGATATGAATTCCCTGACAGAC -3'
Posted On 2014-01-29