Mutagenetix > Incidental Mutations

Incidental Mutation 'R1282:Exoc3'

151071

Institutional Source

Beutler Lab

Gene Symbol

Exoc3

Ensembl Gene

ENSMUSG00000034152

Gene Name

exocyst complex component 3

Synonyms

Sec6l1, E430013E20Rik, 2810050O03Rik

MMRRC Submission

039348-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R1282 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74169488-74208732 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74182292 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 506 (N506S)

Ref Sequence

ENSEMBL: ENSMUSP00000039416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035934]

Predicted Effect

probably benign
Transcript: ENSMUST00000035934
AA Change: N506S

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152
AA Change: N506S

Domain	Start	End	E-Value	Type
Pfam:Sec6	187	743	1.7e-162	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	T	6: 149,329,172	Q1239*	probably null	Het
Acmsd	T	C	1: 127,738,560	Y23H	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Atp2a2	G	T	5: 122,491,754	T84K	probably benign	Het
Cfap65	T	A	1: 74,925,104	T562S	probably benign	Het
Cyp2b10	G	A	7: 25,926,080	C436Y	probably damaging	Het
Dnajc7	T	C	11: 100,584,641	D381G	probably damaging	Het
Dnase1l3	T	C	14: 7,983,117	D129G	probably benign	Het
Espl1	A	G	15: 102,315,391	T1126A	probably benign	Het
Fastkd3	C	A	13: 68,584,557	N332K	possibly damaging	Het
Fbxw15	G	A	9: 109,558,246	S227F	probably damaging	Het
Foxp4	G	A	17: 47,875,643	P404S	unknown	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Gm12789	T	A	4: 101,988,290	W59R	probably damaging	Het
Greb1l	T	A	18: 10,547,289	N1502K	probably benign	Het
H2-K1	A	C	17: 33,999,447	I165S	probably damaging	Het
Ipo9	A	G	1: 135,402,292	I470T	possibly damaging	Het
Kcnu1	A	T	8: 25,905,957	I657F	probably benign	Het
Lrp1b	A	T	2: 40,860,761	N2930K	probably damaging	Het
Olfr683	T	A	7: 105,143,652	I220F	probably benign	Het
Prag1	T	C	8: 36,099,914	V73A	probably damaging	Het
Prrc2b	T	C	2: 32,223,444	I1963T	probably damaging	Het
Rep15	C	T	6: 147,033,229	R189*	probably null	Het
Rtp3	T	C	9: 110,986,920	K188E	probably benign	Het
Scd2	T	C	19: 44,295,181	L101P	probably damaging	Het
Scn7a	A	T	2: 66,700,849	H561Q	probably damaging	Het
Sfr1	T	C	19: 47,732,968	S118P	probably damaging	Het
Slf1	C	T	13: 77,043,840	M958I	probably damaging	Het
Snrk	G	T	9: 122,160,520	R310L	possibly damaging	Het
Snx11	T	C	11: 96,773,161	Y35C	probably damaging	Het
Supt6	T	C	11: 78,228,768	T404A	possibly damaging	Het
Svep1	C	A	4: 58,100,032	L1337F	possibly damaging	Het
Traf3ip2	C	T	10: 39,626,405	T183M	probably damaging	Het
Vmn2r28	A	T	7: 5,481,302	M633K	probably damaging	Het
Vmn2r67	A	G	7: 85,136,724	V691A	probably benign	Het

Other mutations in Exoc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Exoc3	APN	13	74206906	critical splice donor site	probably null
IGL01444:Exoc3	APN	13	74206935	missense	probably damaging	1.00
IGL02095:Exoc3	APN	13	74180536	missense	probably damaging	1.00
IGL02370:Exoc3	APN	13	74192761	missense	probably benign	0.02
IGL02704:Exoc3	APN	13	74174144	missense	probably benign	0.00
IGL03113:Exoc3	APN	13	74193113	nonsense	probably null
R0037:Exoc3	UTSW	13	74199539	missense	probably damaging	0.99
R0565:Exoc3	UTSW	13	74182275	critical splice donor site	probably null
R1438:Exoc3	UTSW	13	74190179	missense	probably damaging	1.00
R1694:Exoc3	UTSW	13	74190065	splice site	probably null
R1913:Exoc3	UTSW	13	74182316	missense	probably damaging	1.00
R1915:Exoc3	UTSW	13	74173294	critical splice donor site	probably null
R2039:Exoc3	UTSW	13	74192977	missense	probably benign
R4272:Exoc3	UTSW	13	74192644	missense	probably damaging	1.00
R4852:Exoc3	UTSW	13	74199645	missense	probably damaging	1.00
R5698:Exoc3	UTSW	13	74174015	missense	probably benign	0.13
R5909:Exoc3	UTSW	13	74199524	missense	probably damaging	0.98
R5969:Exoc3	UTSW	13	74172186	nonsense	probably null
R6248:Exoc3	UTSW	13	74182281	missense	probably benign	0.40
R6433:Exoc3	UTSW	13	74189187	missense	possibly damaging	0.93
R6599:Exoc3	UTSW	13	74189158	splice site	probably null
R6861:Exoc3	UTSW	13	74189200	missense	probably benign
R7000:Exoc3	UTSW	13	74182166	missense	probably benign	0.41
R7384:Exoc3	UTSW	13	74172156	missense	probably benign	0.00
R8098:Exoc3	UTSW	13	74172152	missense	probably benign
R8146:Exoc3	UTSW	13	74192665	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCAGACAAGCCTTTGACTGTAGC -3'
(R):5'- GACTCCTCTGGTCCAAAAGTGGTG -3'

Sequencing Primer
(F):5'- CCTTAGCAATGGCGTCTAGAATC -3'
(R):5'- GGTGATATGAATTCCCTGACAGAC -3'

Posted On

2014-01-29