Incidental Mutation 'R1249:Slc13a1'
ID151699
Institutional Source Beutler Lab
Gene Symbol Slc13a1
Ensembl Gene ENSMUSG00000029700
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 1
SynonymsNaSi-1, Nas1
MMRRC Submission 039316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1249 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24088283-24168092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24133650 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 201 (P201Q)
Ref Sequence ENSEMBL: ENSMUSP00000031713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031713]
Predicted Effect probably benign
Transcript: ENSMUST00000031713
AA Change: P201Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031713
Gene: ENSMUSG00000029700
AA Change: P201Q

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 578 9.6e-101 PFAM
Pfam:CitMHS 45 168 3.9e-14 PFAM
Pfam:CitMHS 226 521 3.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176692
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apical membrane Na(+)-sulfate cotransporter involved in sulfate homeostasis in the kidney. Defects in this gene lead to many pathophysiologic problems. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit hyposulfatemia, growth retardation, reduced female fertility, and spontaneous clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b2 A C 3: 89,947,804 N586K possibly damaging Het
Clca3a2 T C 3: 144,803,004 R685G possibly damaging Het
Cpxm2 A G 7: 132,128,350 probably null Het
Dsg4 A T 18: 20,446,872 R45* probably null Het
Lama4 A G 10: 39,075,478 E1073G probably damaging Het
Mug1 A G 6: 121,849,461 I167V probably benign Het
Olfr1509 G A 14: 52,450,522 M36I probably benign Het
Prox1 C T 1: 190,147,061 R640H possibly damaging Het
Rad50 T A 11: 53,692,137 E476D probably damaging Het
Sars A G 3: 108,435,935 V80A probably benign Het
Setd2 T A 9: 110,573,880 M1863K probably damaging Het
Taok1 A C 11: 77,571,637 W209G probably damaging Het
Vmn1r217 T A 13: 23,114,648 H28L probably benign Het
Other mutations in Slc13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc13a1 APN 6 24118017 missense possibly damaging 0.55
IGL01096:Slc13a1 APN 6 24104077 missense probably damaging 0.97
IGL01788:Slc13a1 APN 6 24134372 missense probably damaging 0.96
IGL02028:Slc13a1 APN 6 24118031 missense probably benign 0.00
IGL02238:Slc13a1 APN 6 24103483 missense probably benign 0.00
IGL02525:Slc13a1 APN 6 24137136 missense probably damaging 1.00
IGL02741:Slc13a1 APN 6 24150708 critical splice donor site probably null
IGL02894:Slc13a1 APN 6 24137042 splice site probably benign
IGL03086:Slc13a1 APN 6 24118003 missense probably damaging 1.00
munchkin UTSW 6 24090796 nonsense probably null
R0294:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R0419:Slc13a1 UTSW 6 24100293 missense probably damaging 0.99
R1401:Slc13a1 UTSW 6 24118083 splice site probably null
R1868:Slc13a1 UTSW 6 24118000 missense probably damaging 1.00
R2191:Slc13a1 UTSW 6 24134397 missense possibly damaging 0.71
R2940:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R3740:Slc13a1 UTSW 6 24134477 missense probably damaging 1.00
R4326:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4327:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4389:Slc13a1 UTSW 6 24092398 splice site probably null
R4520:Slc13a1 UTSW 6 24134513 missense probably benign 0.18
R4771:Slc13a1 UTSW 6 24100340 nonsense probably null
R4883:Slc13a1 UTSW 6 24134357 missense probably benign 0.01
R5133:Slc13a1 UTSW 6 24103429 missense possibly damaging 0.95
R5213:Slc13a1 UTSW 6 24108159 missense probably damaging 1.00
R5310:Slc13a1 UTSW 6 24134374 missense probably benign 0.02
R5504:Slc13a1 UTSW 6 24150744 missense possibly damaging 0.83
R5971:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
R6214:Slc13a1 UTSW 6 24090796 nonsense probably null
R6215:Slc13a1 UTSW 6 24090796 nonsense probably null
R6526:Slc13a1 UTSW 6 24097612 missense probably damaging 0.97
R6562:Slc13a1 UTSW 6 24150793 missense probably benign 0.35
R6573:Slc13a1 UTSW 6 24137095 missense probably damaging 1.00
R6902:Slc13a1 UTSW 6 24097666 missense possibly damaging 0.65
R7184:Slc13a1 UTSW 6 24092312 missense probably damaging 0.99
R7536:Slc13a1 UTSW 6 24100331 missense probably damaging 1.00
R7918:Slc13a1 UTSW 6 24118066 missense probably benign 0.35
U15987:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
Z1177:Slc13a1 UTSW 6 24133695 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCATCGTACCACACTTGGACTTTT -3'
(R):5'- TCTGATGAACTGCTTGGATGCAATGAA -3'

Sequencing Primer
(F):5'- ATAGGCATGTATCCAGTTAGGC -3'
(R):5'- CTGCTTGGATGCAATGAAAGATG -3'
Posted On2014-01-29