Incidental Mutation 'R6902:Slc13a1'
ID538582
Institutional Source Beutler Lab
Gene Symbol Slc13a1
Ensembl Gene ENSMUSG00000029700
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 1
SynonymsNaSi-1, Nas1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6902 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24088283-24168092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24097666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 421 (I421V)
Ref Sequence ENSEMBL: ENSMUSP00000031713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031713
AA Change: I421V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031713
Gene: ENSMUSG00000029700
AA Change: I421V

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 578 9.6e-101 PFAM
Pfam:CitMHS 45 168 3.9e-14 PFAM
Pfam:CitMHS 226 521 3.9e-16 PFAM
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apical membrane Na(+)-sulfate cotransporter involved in sulfate homeostasis in the kidney. Defects in this gene lead to many pathophysiologic problems. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit hyposulfatemia, growth retardation, reduced female fertility, and spontaneous clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C G 13: 119,488,144 probably benign Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in Slc13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc13a1 APN 6 24118017 missense possibly damaging 0.55
IGL01096:Slc13a1 APN 6 24104077 missense probably damaging 0.97
IGL01788:Slc13a1 APN 6 24134372 missense probably damaging 0.96
IGL02028:Slc13a1 APN 6 24118031 missense probably benign 0.00
IGL02238:Slc13a1 APN 6 24103483 missense probably benign 0.00
IGL02525:Slc13a1 APN 6 24137136 missense probably damaging 1.00
IGL02741:Slc13a1 APN 6 24150708 critical splice donor site probably null
IGL02894:Slc13a1 APN 6 24137042 splice site probably benign
IGL03086:Slc13a1 APN 6 24118003 missense probably damaging 1.00
munchkin UTSW 6 24090796 nonsense probably null
R0294:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R0419:Slc13a1 UTSW 6 24100293 missense probably damaging 0.99
R1249:Slc13a1 UTSW 6 24133650 missense probably benign 0.01
R1401:Slc13a1 UTSW 6 24118083 splice site probably null
R1868:Slc13a1 UTSW 6 24118000 missense probably damaging 1.00
R2191:Slc13a1 UTSW 6 24134397 missense possibly damaging 0.71
R2940:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R3740:Slc13a1 UTSW 6 24134477 missense probably damaging 1.00
R4326:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4327:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4389:Slc13a1 UTSW 6 24092398 splice site probably null
R4520:Slc13a1 UTSW 6 24134513 missense probably benign 0.18
R4771:Slc13a1 UTSW 6 24100340 nonsense probably null
R4883:Slc13a1 UTSW 6 24134357 missense probably benign 0.01
R5133:Slc13a1 UTSW 6 24103429 missense possibly damaging 0.95
R5213:Slc13a1 UTSW 6 24108159 missense probably damaging 1.00
R5310:Slc13a1 UTSW 6 24134374 missense probably benign 0.02
R5504:Slc13a1 UTSW 6 24150744 missense possibly damaging 0.83
R5971:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
R6214:Slc13a1 UTSW 6 24090796 nonsense probably null
R6215:Slc13a1 UTSW 6 24090796 nonsense probably null
R6526:Slc13a1 UTSW 6 24097612 missense probably damaging 0.97
R6562:Slc13a1 UTSW 6 24150793 missense probably benign 0.35
R6573:Slc13a1 UTSW 6 24137095 missense probably damaging 1.00
R7184:Slc13a1 UTSW 6 24092312 missense probably damaging 0.99
R7536:Slc13a1 UTSW 6 24100331 missense probably damaging 1.00
R7918:Slc13a1 UTSW 6 24118066 missense probably benign 0.35
U15987:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
Z1177:Slc13a1 UTSW 6 24133695 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTTGACATTCCTGAACACACATC -3'
(R):5'- TCAGTGGAAACTCTTAGTCCATGTC -3'

Sequencing Primer
(F):5'- CTTGAACTATGAACACACATCATCTG -3'
(R):5'- GTCAAATCTCTGCCTTGAAAACAG -3'
Posted On2018-11-06