Mutagenetix > Incidental Mutations

Incidental Mutation 'R1249:Atp8b2'

151696

Institutional Source

Beutler Lab

Gene Symbol

Atp8b2

Ensembl Gene

ENSMUSG00000060671

Gene Name

ATPase, class I, type 8B, member 2

Synonyms

MMRRC Submission

039316-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R1249 (G1)

Quality Score

136

Status

Not validated

Chromosome

Chromosomal Location

89939481-89963508 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 89947804 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 586 (N586K)

Ref Sequence

ENSEMBL: ENSMUSP00000128423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000166502] [ENSMUST00000168276] [ENSMUST00000170739]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069805
AA Change: N605K

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: N605K

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
low complexity region	80	96	N/A	INTRINSIC
Pfam:E1-E2_ATPase	103	374	5.6e-18	PFAM
Pfam:HAD	408	842	1.3e-17	PFAM
Pfam:Hydrolase_like2	491	590	1e-11	PFAM
Pfam:Hydrolase	590	845	7.9e-8	PFAM
low complexity region	1133	1147	N/A	INTRINSIC
low complexity region	1167	1190	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107396
AA Change: N586K

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: N586K

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	15	81	1.3e-29	PFAM
Pfam:E1-E2_ATPase	81	351	2.7e-9	PFAM
Pfam:HAD	389	847	1.5e-17	PFAM
Pfam:Cation_ATPase	472	571	4.3e-12	PFAM
Pfam:PhoLip_ATPase_C	864	1118	2e-84	PFAM
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1172	1195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166347

Predicted Effect

probably benign
Transcript: ENSMUST00000166502

SMART Domains

Protein: ENSMUSP00000132201
Gene: ENSMUSG00000060671

Domain	Start	End	E-Value	Type
SCOP:d1eula_	2	95	5e-7	SMART
low complexity region	100	109	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167257

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167442

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168276
AA Change: N586K

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: N586K

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	77	N/A	INTRINSIC
Pfam:E1-E2_ATPase	84	355	2.5e-18	PFAM
Pfam:HAD	389	823	7.9e-18	PFAM
Pfam:Hydrolase_like2	472	571	3.6e-12	PFAM
Pfam:Hydrolase	571	826	6.5e-8	PFAM
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1148	1171	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170324

Predicted Effect

probably benign
Transcript: ENSMUST00000170739

SMART Domains

Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

Domain	Start	End	E-Value	Type
Pfam:Hydrolase_like2	1	82	1.4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171818

Predicted Effect

probably benign
Transcript: ENSMUST00000171941

SMART Domains

Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671

Domain	Start	End	E-Value	Type
Pfam:HAD	2	158	3.3e-8	PFAM
Pfam:Hydrolase_3	124	167	1.7e-6	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Clca3a2	T	C	3: 144,803,004	R685G	possibly damaging	Het
Cpxm2	A	G	7: 132,128,350		probably null	Het
Dsg4	A	T	18: 20,446,872	R45*	probably null	Het
Lama4	A	G	10: 39,075,478	E1073G	probably damaging	Het
Mug1	A	G	6: 121,849,461	I167V	probably benign	Het
Olfr1509	G	A	14: 52,450,522	M36I	probably benign	Het
Prox1	C	T	1: 190,147,061	R640H	possibly damaging	Het
Rad50	T	A	11: 53,692,137	E476D	probably damaging	Het
Sars	A	G	3: 108,435,935	V80A	probably benign	Het
Setd2	T	A	9: 110,573,880	M1863K	probably damaging	Het
Slc13a1	G	T	6: 24,133,650	P201Q	probably benign	Het
Taok1	A	C	11: 77,571,637	W209G	probably damaging	Het
Vmn1r217	T	A	13: 23,114,648	H28L	probably benign	Het

Other mutations in Atp8b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02313:Atp8b2	APN	3	89949853	missense	probably damaging	1.00
IGL02472:Atp8b2	APN	3	89954239	missense	probably damaging	1.00
IGL02651:Atp8b2	APN	3	89954589	unclassified	probably null
IGL03057:Atp8b2	APN	3	89944186	missense	probably damaging	1.00
IGL03349:Atp8b2	APN	3	89957817	missense	probably damaging	1.00
IGL03382:Atp8b2	APN	3	89948521	missense	probably benign	0.00
R0550:Atp8b2	UTSW	3	89959061	splice site	probably benign
R0784:Atp8b2	UTSW	3	89957073	missense	probably damaging	0.99
R1447:Atp8b2	UTSW	3	89944170	missense	probably damaging	1.00
R1568:Atp8b2	UTSW	3	89949848	missense	probably damaging	0.98
R1647:Atp8b2	UTSW	3	89941784	missense	probably benign	0.30
R1736:Atp8b2	UTSW	3	89952694	missense	probably damaging	0.98
R1907:Atp8b2	UTSW	3	89946276	missense	probably benign	0.28
R2656:Atp8b2	UTSW	3	89941758	missense	probably benign	0.05
R2888:Atp8b2	UTSW	3	89958293	missense	probably damaging	1.00
R3706:Atp8b2	UTSW	3	89945152	missense	probably damaging	0.99
R3708:Atp8b2	UTSW	3	89945152	missense	probably damaging	0.99
R3740:Atp8b2	UTSW	3	89946031	missense	probably benign
R3741:Atp8b2	UTSW	3	89946031	missense	probably benign
R3742:Atp8b2	UTSW	3	89946031	missense	probably benign
R3896:Atp8b2	UTSW	3	89957319	missense	probably damaging	1.00
R3914:Atp8b2	UTSW	3	89954448	missense	probably damaging	0.98
R4536:Atp8b2	UTSW	3	89941784	missense	probably benign	0.30
R4770:Atp8b2	UTSW	3	89957067	missense	probably damaging	0.97
R4859:Atp8b2	UTSW	3	89945980	missense	probably benign
R4905:Atp8b2	UTSW	3	89949008	missense	probably benign
R4925:Atp8b2	UTSW	3	89946623	critical splice donor site	probably null
R4955:Atp8b2	UTSW	3	89952920	unclassified	probably benign
R5433:Atp8b2	UTSW	3	89952909	unclassified	probably benign
R5458:Atp8b2	UTSW	3	89946022	missense	probably benign	0.00
R5517:Atp8b2	UTSW	3	89946031	missense	probably benign
R5663:Atp8b2	UTSW	3	89941794	missense	probably benign	0.19
R6056:Atp8b2	UTSW	3	89946221	missense	possibly damaging	0.79
R6821:Atp8b2	UTSW	3	89948173	missense	probably damaging	0.99
R7069:Atp8b2	UTSW	3	89954571	missense	probably damaging	1.00
R7178:Atp8b2	UTSW	3	89943672	missense	possibly damaging	0.88
R7533:Atp8b2	UTSW	3	89945524	missense
R7552:Atp8b2	UTSW	3	89946764	missense	probably damaging	1.00
Z1088:Atp8b2	UTSW	3	89954568	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCAGGCCGTGCTCATTT -3'
(R):5'- CCAATACCAGGGAGCTGAGGAGA -3'

Sequencing Primer
(F):5'- tccccagagcccacaag -3'
(R):5'- CCTGGGACAGCAGATAGGC -3'

Posted On

2014-01-29