Incidental Mutation 'R1252:Pqlc1'
ID151824
Institutional Source Beutler Lab
Gene Symbol Pqlc1
Ensembl Gene ENSMUSG00000034006
Gene NamePQ loop repeat containing 1
SynonymsC78974, 2310009N05Rik, 5730564E11Rik, 4933425L21Rik
MMRRC Submission 039319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1252 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80253292-80292725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80291598 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 211 (T211A)
Ref Sequence ENSEMBL: ENSMUSP00000119083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070135] [ENSMUST00000077962] [ENSMUST00000091798] [ENSMUST00000123750] [ENSMUST00000129043] [ENSMUST00000131780] [ENSMUST00000140594]
Predicted Effect probably benign
Transcript: ENSMUST00000070135
AA Change: T193A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069986
Gene: ENSMUSG00000034006
AA Change: T193A

DomainStartEndE-ValueType
CTNS 31 62 6.86e-1 SMART
transmembrane domain 78 100 N/A INTRINSIC
CTNS 166 197 7.56e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077962
SMART Domains Protein: ENSMUSP00000077112
Gene: ENSMUSG00000059852

DomainStartEndE-ValueType
BTB 31 139 9.55e-4 SMART
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Ion_trans 233 417 7.1e-27 PFAM
Pfam:Ion_trans_2 336 423 3.5e-15 PFAM
low complexity region 445 458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091798
AA Change: T211A

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089402
Gene: ENSMUSG00000034006
AA Change: T211A

DomainStartEndE-ValueType
CTNS 31 62 6.86e-1 SMART
transmembrane domain 78 100 N/A INTRINSIC
CTNS 184 215 7.56e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123750
AA Change: T193A

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121890
Gene: ENSMUSG00000034006
AA Change: T193A

DomainStartEndE-ValueType
CTNS 31 62 6.86e-1 SMART
transmembrane domain 78 100 N/A INTRINSIC
CTNS 166 197 7.56e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129043
AA Change: T193A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118670
Gene: ENSMUSG00000034006
AA Change: T193A

DomainStartEndE-ValueType
CTNS 31 62 6.86e-1 SMART
transmembrane domain 78 100 N/A INTRINSIC
CTNS 166 197 7.56e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131780
AA Change: T211A

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117166
Gene: ENSMUSG00000034006
AA Change: T211A

DomainStartEndE-ValueType
CTNS 31 62 6.86e-1 SMART
transmembrane domain 78 100 N/A INTRINSIC
CTNS 184 215 7.56e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140594
AA Change: T211A

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119083
Gene: ENSMUSG00000034006
AA Change: T211A

DomainStartEndE-ValueType
CTNS 31 62 6.86e-1 SMART
transmembrane domain 78 100 N/A INTRINSIC
CTNS 184 215 7.56e-9 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Arfgef2 A G 2: 166,859,957 K755E probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gm281 T C 14: 13,862,444 D370G probably benign Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Krt83 A G 15: 101,487,830 Y295H probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lpl A G 8: 68,892,659 D105G probably benign Het
Lrrc45 C A 11: 120,715,471 T135N probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nmbr T C 10: 14,760,443 I52T probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Slc23a2 A T 2: 132,062,197 probably null Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Pqlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0255:Pqlc1 UTSW 18 80263518 missense probably benign 0.34
R1381:Pqlc1 UTSW 18 80283314 missense probably benign
R2061:Pqlc1 UTSW 18 80291715 missense probably benign 0.04
R4343:Pqlc1 UTSW 18 80283789 unclassified probably benign
R5678:Pqlc1 UTSW 18 80257034 missense probably damaging 1.00
R5701:Pqlc1 UTSW 18 80272478 missense possibly damaging 0.89
R5805:Pqlc1 UTSW 18 80263443 missense probably damaging 1.00
X0065:Pqlc1 UTSW 18 80283302 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTACTAGGCCAGGCTGAAGAAC -3'
(R):5'- GGACGCGGCACTCAACTTAATCTC -3'

Sequencing Primer
(F):5'- GGCTGTAATCAGACCATTCTCG -3'
(R):5'- CTAGATTCCTCAGAGAGCCTTGG -3'
Posted On2014-01-29