Incidental Mutation 'R1374:Obox1'
ID157439
Institutional Source Beutler Lab
Gene Symbol Obox1
Ensembl Gene ENSMUSG00000054310
Gene Nameoocyte specific homeobox 1
Synonyms
MMRRC Submission 039438-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R1374 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location15388948-15556866 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 15555501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067288] [ENSMUST00000086122] [ENSMUST00000172463] [ENSMUST00000172881] [ENSMUST00000173245] [ENSMUST00000173443] [ENSMUST00000181001]
Predicted Effect probably benign
Transcript: ENSMUST00000067288
SMART Domains Protein: ENSMUSP00000067691
Gene: ENSMUSG00000054310

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086122
SMART Domains Protein: ENSMUSP00000083291
Gene: ENSMUSG00000066772

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172463
SMART Domains Protein: ENSMUSP00000133504
Gene: ENSMUSG00000054310

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172881
SMART Domains Protein: ENSMUSP00000134688
Gene: ENSMUSG00000054310

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173245
SMART Domains Protein: ENSMUSP00000133496
Gene: ENSMUSG00000054310

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173443
SMART Domains Protein: ENSMUSP00000134043
Gene: ENSMUSG00000054310

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181001
SMART Domains Protein: ENSMUSP00000138010
Gene: ENSMUSG00000054310

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 G A 5: 142,470,458 R344H probably damaging Het
C77080 A G 4: 129,222,289 S849P possibly damaging Het
Ccdc38 C T 10: 93,582,434 probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Cyp2a4 A G 7: 26,312,923 D377G probably damaging Het
Ddb1 G A 19: 10,608,318 G132D probably damaging Het
Dlgap2 T C 8: 14,831,228 probably benign Het
Epg5 A G 18: 77,981,326 D1132G probably benign Het
Fam184b T C 5: 45,555,143 E511G probably benign Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Gpatch1 A T 7: 35,291,762 L619Q probably damaging Het
Inpp4b T G 8: 81,743,816 probably null Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Klhl30 C T 1: 91,361,076 T519M probably damaging Het
Klhl8 A C 5: 103,863,183 L516R probably damaging Het
Meikin T A 11: 54,398,444 probably benign Het
Mlph T A 1: 90,941,703 S476T probably damaging Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Nfxl1 G A 5: 72,524,145 T681I probably benign Het
Oplah G A 15: 76,306,555 R31C probably damaging Het
Polb T C 8: 22,653,057 probably benign Het
Ppfibp2 A G 7: 107,685,988 probably benign Het
Prr12 A G 7: 45,046,218 S1275P unknown Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Ranbp2 T C 10: 58,485,893 probably benign Het
Rapgef2 A G 3: 79,087,968 V791A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Ripor2 T C 13: 24,673,112 probably null Het
Sae1 A G 7: 16,378,408 I60T probably damaging Het
Tenm2 T C 11: 36,008,454 T2626A probably benign Het
Trrap A G 5: 144,846,618 Q3419R probably damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zfp248 A G 6: 118,433,373 L25P probably damaging Het
Zmym1 T A 4: 127,049,611 K230I probably damaging Het
Other mutations in Obox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0420:Obox1 UTSW 7 15556253 missense possibly damaging 0.90
R1527:Obox1 UTSW 7 15555325 missense probably damaging 1.00
R1984:Obox1 UTSW 7 15555210 missense probably benign 0.18
R4585:Obox1 UTSW 7 15556227 missense possibly damaging 0.66
R4586:Obox1 UTSW 7 15556227 missense possibly damaging 0.66
R4680:Obox1 UTSW 7 15556164 missense probably damaging 1.00
R4883:Obox1 UTSW 7 15556338 missense probably damaging 1.00
R5742:Obox1 UTSW 7 15555505 missense possibly damaging 0.73
R6331:Obox1 UTSW 7 15555369 missense probably benign 0.00
R6596:Obox1 UTSW 7 15555376 missense probably damaging 1.00
R7442:Obox1 UTSW 7 15555566 missense probably benign 0.00
R7919:Obox1 UTSW 7 15556331 nonsense probably null
R7946:Obox1 UTSW 7 15555531 missense probably benign 0.38
R8275:Obox1 UTSW 7 15556228 missense probably damaging 1.00
R8447:Obox1 UTSW 7 15555616 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTTTCAAATGCGTCAGAGTCCC -3'
(R):5'- TGTAACACCAACTGATAGTGCCAGC -3'

Sequencing Primer
(F):5'- GAAATCAAGTCTTTCAGTCCCTG -3'
(R):5'- CTGATAGTGCCAGCTCCAC -3'
Posted On2014-02-18